ID: 1080413679

View in Genome Browser
Species Human (GRCh38)
Location 11:32050018-32050040
Sequence TTGGACCTGTGGGGAGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080413679_1080413690 7 Left 1080413679 11:32050018-32050040 CCGTGGCCTCCCCACAGGTCCAA 0: 1
1: 0
2: 0
3: 18
4: 290
Right 1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG 0: 1
1: 0
2: 4
3: 26
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080413679 Original CRISPR TTGGACCTGTGGGGAGGCCA CGG (reversed) Intronic