ID: 1080413680

View in Genome Browser
Species Human (GRCh38)
Location 11:32050024-32050046
Sequence ATGGGATTGGACCTGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080413680_1080413694 26 Left 1080413680 11:32050024-32050046 CCTCCCCACAGGTCCAATCCCAT 0: 1
1: 0
2: 1
3: 11
4: 218
Right 1080413694 11:32050073-32050095 CCACTAGCCTAAGAAGTTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 123
1080413680_1080413692 25 Left 1080413680 11:32050024-32050046 CCTCCCCACAGGTCCAATCCCAT 0: 1
1: 0
2: 1
3: 11
4: 218
Right 1080413692 11:32050072-32050094 TCCACTAGCCTAAGAAGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1080413680_1080413690 1 Left 1080413680 11:32050024-32050046 CCTCCCCACAGGTCCAATCCCAT 0: 1
1: 0
2: 1
3: 11
4: 218
Right 1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG 0: 1
1: 0
2: 4
3: 26
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080413680 Original CRISPR ATGGGATTGGACCTGTGGGG AGG (reversed) Intronic