ID: 1080413681

View in Genome Browser
Species Human (GRCh38)
Location 11:32050027-32050049
Sequence CAAATGGGATTGGACCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080413681_1080413692 22 Left 1080413681 11:32050027-32050049 CCCCACAGGTCCAATCCCATTTG 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1080413692 11:32050072-32050094 TCCACTAGCCTAAGAAGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1080413681_1080413690 -2 Left 1080413681 11:32050027-32050049 CCCCACAGGTCCAATCCCATTTG 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG 0: 1
1: 0
2: 4
3: 26
4: 228
1080413681_1080413694 23 Left 1080413681 11:32050027-32050049 CCCCACAGGTCCAATCCCATTTG 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1080413694 11:32050073-32050095 CCACTAGCCTAAGAAGTTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080413681 Original CRISPR CAAATGGGATTGGACCTGTG GGG (reversed) Intronic