ID: 1080413684

View in Genome Browser
Species Human (GRCh38)
Location 11:32050029-32050051
Sequence CCCAAATGGGATTGGACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080413684_1080413692 20 Left 1080413684 11:32050029-32050051 CCACAGGTCCAATCCCATTTGGG 0: 1
1: 0
2: 1
3: 17
4: 119
Right 1080413692 11:32050072-32050094 TCCACTAGCCTAAGAAGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1080413684_1080413694 21 Left 1080413684 11:32050029-32050051 CCACAGGTCCAATCCCATTTGGG 0: 1
1: 0
2: 1
3: 17
4: 119
Right 1080413694 11:32050073-32050095 CCACTAGCCTAAGAAGTTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 123
1080413684_1080413690 -4 Left 1080413684 11:32050029-32050051 CCACAGGTCCAATCCCATTTGGG 0: 1
1: 0
2: 1
3: 17
4: 119
Right 1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG 0: 1
1: 0
2: 4
3: 26
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080413684 Original CRISPR CCCAAATGGGATTGGACCTG TGG (reversed) Intronic