ID: 1080413690

View in Genome Browser
Species Human (GRCh38)
Location 11:32050048-32050070
Sequence TGGGGTGATTCTGCCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080413681_1080413690 -2 Left 1080413681 11:32050027-32050049 CCCCACAGGTCCAATCCCATTTG 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG 0: 1
1: 0
2: 4
3: 26
4: 228
1080413684_1080413690 -4 Left 1080413684 11:32050029-32050051 CCACAGGTCCAATCCCATTTGGG 0: 1
1: 0
2: 1
3: 17
4: 119
Right 1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG 0: 1
1: 0
2: 4
3: 26
4: 228
1080413682_1080413690 -3 Left 1080413682 11:32050028-32050050 CCCACAGGTCCAATCCCATTTGG 0: 1
1: 0
2: 0
3: 29
4: 226
Right 1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG 0: 1
1: 0
2: 4
3: 26
4: 228
1080413679_1080413690 7 Left 1080413679 11:32050018-32050040 CCGTGGCCTCCCCACAGGTCCAA 0: 1
1: 0
2: 0
3: 18
4: 290
Right 1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG 0: 1
1: 0
2: 4
3: 26
4: 228
1080413680_1080413690 1 Left 1080413680 11:32050024-32050046 CCTCCCCACAGGTCCAATCCCAT 0: 1
1: 0
2: 1
3: 11
4: 218
Right 1080413690 11:32050048-32050070 TGGGGTGATTCTGCCTCTGCTGG 0: 1
1: 0
2: 4
3: 26
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080413690 Original CRISPR TGGGGTGATTCTGCCTCTGC TGG Intronic