ID: 1080415908

View in Genome Browser
Species Human (GRCh38)
Location 11:32069996-32070018
Sequence TTCAGGTACAGCTTGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 3, 1: 5, 2: 49, 3: 170, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080415904_1080415908 7 Left 1080415904 11:32069966-32069988 CCTCACATAATTGAGAAATGAGG 0: 1
1: 0
2: 2
3: 27
4: 223
Right 1080415908 11:32069996-32070018 TTCAGGTACAGCTTGATCCAGGG 0: 3
1: 5
2: 49
3: 170
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080415908 Original CRISPR TTCAGGTACAGCTTGATCCA GGG Intronic
900033330 1:386965-386987 TTCAGGCATGGCTTGATCCAGGG - Intergenic
900054168 1:616854-616876 TTCAGGCATGGCTTGATCCAGGG - Intergenic
901508684 1:9702989-9703011 TTCAGGCATGGCTGGATCCAGGG + Intronic
901783848 1:11611758-11611780 TTCAGACACAGCTGAATCCAGGG + Intergenic
901840114 1:11949014-11949036 TTCAGGCATGGCTGGATCCAGGG + Intronic
901866261 1:12109026-12109048 TTCAGGCATGGCTGGATCCAGGG + Intronic
902117255 1:14131750-14131772 TTCAGGTGAGGCTTGATTCAGGG + Intergenic
902200518 1:14830124-14830146 TTCAGGCACAGCTGGATCCAGGG + Intronic
902669887 1:17965880-17965902 TTCAGGCACAGCCTGATCCAGGG - Intergenic
902905570 1:19554268-19554290 TTCAGGTATGGCTGGATCCAGGG - Intergenic
903060966 1:20668359-20668381 TTCAGGCACGGCTGGATCTAGGG - Intronic
903298058 1:22358397-22358419 TTCAGGCATGGCTGGATCCAGGG - Intergenic
904265524 1:29316574-29316596 TTCAGTTGTAGCTGGATCCAGGG + Intronic
904508627 1:30981782-30981804 TACAGGTCCTGCCTGATCCAAGG + Intronic
904525377 1:31129558-31129580 TTCAGGGATGGCTAGATCCAGGG + Intergenic
904588238 1:31592126-31592148 TCCAGGCACAGCTGGAACCAGGG + Intergenic
905744812 1:40406046-40406068 TTCAATTACAGGTTGAGCCATGG + Intronic
906638808 1:47428691-47428713 TTCAGGCAGAGCTGGATCCAGGG + Intergenic
907875049 1:58477761-58477783 TTCAGGCACAGTTTAATCCAGGG - Intronic
908896559 1:68907493-68907515 TTCAGATACAGCTGGAACCAGGG - Intergenic
910741170 1:90518105-90518127 TTCAGGTACAGCTTAAAACTAGG - Intergenic
911195164 1:94987187-94987209 TTCAGGCACAACTGGATTCATGG - Intronic
911242098 1:95478254-95478276 TCAAGGTACAGCTTGGGCCATGG + Intergenic
912221108 1:107676539-107676561 TTCAGGCAGAGATGGATCCAGGG - Intronic
912987086 1:114444495-114444517 CTAAGGTACAGCTTACTCCAGGG - Intronic
916426574 1:164686664-164686686 GTCAGGTACATCTTCAGCCATGG + Intronic
916658681 1:166900971-166900993 TTCAGGAAGAGCTTGGTCTAGGG - Intergenic
917002500 1:170375154-170375176 CCCAGGTACAGCTTGGGCCATGG - Intergenic
921259532 1:213373419-213373441 TTCAGGAACAGCTGGATCCAAGG - Intergenic
921556070 1:216600549-216600571 TACATGTGCAGCTTGTTCCATGG + Intronic
922255690 1:223891119-223891141 TTCAGGCATGGCTTGATCCAGGG - Intergenic
923342980 1:233023141-233023163 TGCAGGAACAGCTAGATCCAGGG - Intronic
924299609 1:242624232-242624254 TTCAAGAACAGCATGATCCCAGG - Intergenic
924331001 1:242940394-242940416 GTCAAGAACAGCTTGAACCAGGG + Intergenic
924336886 1:242993984-242994006 TTCAGGCATGGCTTGATCCAGGG - Intergenic
924556226 1:245121355-245121377 TTCAGATGCAGCTTGATCCAGGG + Intronic
1064136156 10:12752550-12752572 TACAAGTACAGCTTGTTACATGG - Intronic
1064450921 10:15441368-15441390 TGAAGATACAGCTTGATCTAAGG + Intergenic
1068449356 10:57165726-57165748 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1070545278 10:77447107-77447129 CTCAGCTACAGCTTCAGCCAAGG + Intronic
1070977603 10:80617705-80617727 TTCAGGCTTTGCTTGATCCAGGG + Intronic
1071400455 10:85263682-85263704 TTCAGGTGCACCTGGATTCAGGG - Intergenic
1071524006 10:86347680-86347702 TTCAGGCATGGCTGGATCCAAGG - Intronic
1071727668 10:88216334-88216356 TTCAGGCACAGCTGGATCTAGGG + Intergenic
1071888217 10:89973360-89973382 TTTAAGGACAGCTTGTTCCAAGG - Intergenic
1072187788 10:93059119-93059141 TTCAGGTGCAGCTTGTGCGAGGG + Exonic
1072247016 10:93552776-93552798 TTTAGGCACATCTGGATCCAGGG - Intergenic
1072785217 10:98274838-98274860 CTTAGGTCCTGCTTGATCCAGGG - Intergenic
1073474695 10:103745257-103745279 TTCAGGCATAGCTGGATCTAGGG - Intronic
1074368392 10:112878609-112878631 TTCAGGTACAGCTGAATCCAGGG - Intergenic
1074372357 10:112910327-112910349 TTCAGGTGTAGCTGGATCCAGGG + Intergenic
1075021522 10:118956054-118956076 TTGAGGCACAGCTGGATCCTAGG - Intergenic
1075453589 10:122570186-122570208 TTCTGCTACAGTTGGATCCAAGG - Exonic
1075920230 10:126205195-126205217 TTCAGGTGTGGCCTGATCCAGGG - Intronic
1076419978 10:130324436-130324458 TTCAGGCACAGCTGGATCCAGGG - Intergenic
1076628658 10:131839444-131839466 TTCAGATACAGCTAGCTCCGTGG + Intergenic
1076882305 10:133245510-133245532 TGCAGGCACGGCTGGATCCAGGG - Intergenic
1079490320 11:20981883-20981905 TTCAGGCAAAGCTGGATTCAGGG + Intronic
1080039599 11:27745330-27745352 TTCAGGTATAGCTGAATCCAAGG - Intergenic
1080415908 11:32069996-32070018 TTCAGGTACAGCTTGATCCAGGG + Intronic
1081703449 11:45166162-45166184 TTCAGGTACAGTTGGATCCAGGG + Intronic
1082866277 11:57902631-57902653 GTTAGGTACAGCTTGTCCCATGG + Intergenic
1084409833 11:69000395-69000417 TTCAGACACAGCTGGATCCAGGG - Intergenic
1084749325 11:71193785-71193807 TGCAGGCACAGATTGTTCCAGGG + Intronic
1085174762 11:74476096-74476118 TTCAGGCACAGATTGATCCAGGG - Intergenic
1085961566 11:81468480-81468502 TTCATGTCCAGCTGAATCCAGGG + Intergenic
1086084906 11:82944291-82944313 TGAAGGTACAGCTTGGGCCATGG - Intronic
1086180943 11:83950788-83950810 GTCAGGAACAGCTTCTTCCAGGG - Intronic
1086503652 11:87479467-87479489 TTTAGGTACAGCTTGGGCCATGG + Intergenic
1087026825 11:93658360-93658382 CTCAGGTATGGCTAGATCCAGGG + Intergenic
1088743787 11:112787553-112787575 TTCAGGCACAGTTTGATACAGGG + Intergenic
1089300208 11:117494013-117494035 TTCATGTACAGCATTAGCCATGG - Intronic
1090202055 11:124864193-124864215 TTCAGGCAGAGCTTGTTCAAGGG - Intergenic
1091754089 12:3040602-3040624 TTCAGGCACAGTTTGTTCCTGGG - Exonic
1093682884 12:22023506-22023528 TCAAGGTACAGCTTGGGCCATGG + Intergenic
1094105614 12:26808220-26808242 TTTAGGTACAACTGGAACCAAGG - Intronic
1096440843 12:51642699-51642721 CTGAGGTACAGCTTCAACCATGG - Intronic
1098003328 12:65968733-65968755 TTTAGGTATGGCTTGATCCAGGG + Intergenic
1098672425 12:73248149-73248171 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1100451495 12:94711186-94711208 TTCAGGTGTAGCTGGATCTAGGG - Intergenic
1100657983 12:96667528-96667550 TTAAGGTACAGCTCGGGCCATGG - Intronic
1100728484 12:97436343-97436365 TTCAGGTATGGTTTGATCCAGGG + Intergenic
1101032057 12:100670448-100670470 TTCAGGCATGGCTAGATCCATGG - Intergenic
1101050984 12:100863947-100863969 TTCAGGCACGGTTTGATCCAGGG + Intronic
1101377655 12:104184676-104184698 TTCAGGCATGGCTGGATCCAGGG + Intergenic
1101517027 12:105446341-105446363 TTCAGGTATAGCTAGATCCAGGG + Intergenic
1101580724 12:106039092-106039114 TTCAGGTCTGGCTGGATCCAGGG - Intergenic
1102006827 12:109594551-109594573 TTCAGGTATAGCTCAATCCAGGG + Intronic
1102236608 12:111297996-111298018 AGCAGGAACAGCTTGAGCCAAGG + Intronic
1102243199 12:111338360-111338382 TTCAGGCTCAGCTTGTGCCAGGG - Exonic
1102525178 12:113507523-113507545 TTCAGGCACAGTTGGATCCAGGG + Intergenic
1102542574 12:113633203-113633225 TTCAGGCATAGCTGGATCCAGGG + Intergenic
1102558500 12:113745566-113745588 TTCAGGTGCAGCTGGACCCAGGG + Intergenic
1102722564 12:115030177-115030199 TTCAGGCATAGTTAGATCCAGGG + Intergenic
1102805742 12:115778684-115778706 TTCAGGCATGGCTGGATCCAGGG + Intergenic
1102807197 12:115792496-115792518 TTCAGTCATGGCTTGATCCAGGG + Intergenic
1102891549 12:116562262-116562284 TTCAGGCACAGGTGGATCCAGGG - Intergenic
1102894992 12:116591825-116591847 TTCAGGCACAACTGGATCAAGGG - Intergenic
1103036046 12:117657343-117657365 TTCAGGTATGGCTGGATCTAAGG - Intronic
1103144187 12:118580073-118580095 TTCAGGCTCAACTGGATCCAGGG + Intergenic
1103208088 12:119145851-119145873 TTCAGGTACAGCTGGATTCAGGG + Intronic
1103227813 12:119303267-119303289 TTCAGGCACAGCTCAATTCAGGG + Intergenic
1103806195 12:123575045-123575067 TTCAGGTATAGCTGAATCCAGGG - Intergenic
1103979267 12:124726022-124726044 TTCAGGCATAGCTGGATCCAGGG + Intergenic
1103981608 12:124740407-124740429 TTCAGGTACAGCTTGATCCGGGG - Intergenic
1103982287 12:124744427-124744449 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1104051602 12:125198309-125198331 TTCAGGTATGGCTGGGTCCAGGG + Intronic
1104055867 12:125229669-125229691 TTCAGGCATAGCTGAATCCAGGG + Intronic
1104064106 12:125292598-125292620 TTCAGGTATGGCTAAATCCAAGG + Intronic
1104086009 12:125474736-125474758 TTTAGGCACAGCTGGATCCAGGG + Intronic
1104114756 12:125738519-125738541 TTCAGGTCTAGCTGAATCCAGGG + Intergenic
1104377416 12:128277260-128277282 TTCAGGCACAGCTGGATCCAGGG + Intronic
1104391946 12:128398193-128398215 TTCAGGCACTGCTGGATTCAGGG + Intronic
1104517977 12:129445612-129445634 TTCAGGCACAGCTGGATCCAGGG - Intronic
1104523041 12:129493065-129493087 TTCAAGTACAGCTGGATACAGGG - Intronic
1104551603 12:129762113-129762135 ATCAGGAACAGATTGATCCAGGG - Intronic
1104564096 12:129864667-129864689 TTCAGGCGTAGCTTGATCCAGGG - Intronic
1104638387 12:130451783-130451805 TTCAGGGACATCTTGAACCAGGG - Intronic
1104654345 12:130562385-130562407 TTCAGGAATGACTTGATCCAGGG + Intronic
1104664343 12:130636796-130636818 TTCAGTTACAGCTTGATCCAGGG - Intronic
1104746758 12:131215525-131215547 TTCAGGTGTGGCTGGATCCAGGG - Intergenic
1104785809 12:131447392-131447414 TTCAGGTGCGGCTGGATCCAGGG + Intergenic
1104814888 12:131639933-131639955 TGCAGGTACAGCTTGATGGATGG + Intergenic
1104899838 12:132182898-132182920 TTCAGGTGTGGCTTGATCCAGGG + Intergenic
1104918852 12:132280153-132280175 TTCAGGCATGGCTTGATCTAGGG - Intronic
1104958709 12:132478109-132478131 TTCAGGTCTAGCTGGATCCAGGG + Intergenic
1105842254 13:24265009-24265031 TTCAGGTCCACATTGCTCCAAGG + Intronic
1106016321 13:25872401-25872423 TTCAGGCAGAGCTGGATCCAGGG - Intronic
1106138798 13:26993707-26993729 TGCAGGGACAGCTTTAGCCAGGG - Intergenic
1108944398 13:56003042-56003064 GTAAGGTACAGCTTGGACCATGG - Intergenic
1110022718 13:70495228-70495250 TTCAGGCACAGCTTTACTCAAGG - Intergenic
1112101689 13:96196849-96196871 TTCAGCTGCAGCTGCATCCATGG + Intronic
1114530749 14:23394243-23394265 TTGAAGTAGAGCTTCATCCAGGG + Exonic
1114536262 14:23424944-23424966 TTGAAGTAGAGCTTCATCCAGGG + Exonic
1117215383 14:53546321-53546343 TTCGGGCACAGCTAGATCCAGGG + Intergenic
1117719563 14:58616112-58616134 GTCAGGTACAGCTTATTGCAAGG + Intergenic
1119108567 14:71948064-71948086 TTCAGGCTTAGCTGGATCCAGGG + Intronic
1119140449 14:72262818-72262840 GTCAGCCACAGCTGGATCCAGGG + Intronic
1119531432 14:75364065-75364087 TTTAGGAACAGCTGGATCCAGGG + Intergenic
1119723948 14:76910550-76910572 TTCAGGCACAGTTTGATCTAGGG - Intergenic
1119751214 14:77078822-77078844 TTCAGGCCAAGCTTGATCCAGGG + Intergenic
1120507769 14:85374916-85374938 TACAGATACAGCTAGATCCAGGG + Intergenic
1120796256 14:88636310-88636332 CTCATGTACACCTTGTTCCATGG + Intronic
1121321209 14:92992680-92992702 TTCAGGTTCTTCTAGATCCAGGG + Intronic
1121432428 14:93897296-93897318 TGCAGGTACAGCTGGCTCCAGGG - Intergenic
1121534406 14:94681409-94681431 TTCAGGTGAGGCTTGATCCAGGG + Intergenic
1122061921 14:99141620-99141642 TTCAGGTACGGCTGGATCCAGGG - Intergenic
1122652579 14:103233512-103233534 TTCAGGTAGGGCTGGATCCAGGG + Intergenic
1123627392 15:22237229-22237251 TTCAGGCACAACTGGATCCAGGG - Intergenic
1124870466 15:33536524-33536546 TTCAGGGACAGCTCCATCCCTGG + Intronic
1125761642 15:42100241-42100263 TTCAGGCAAAGCTCGATCCAAGG - Intergenic
1127222316 15:56892689-56892711 TTAAGGCATAGTTTGATCCAAGG + Intronic
1127292980 15:57586690-57586712 TTCAAATTCAGCCTGATCCATGG - Intergenic
1127670850 15:61193514-61193536 TTCAGGAAGGGCTGGATCCAGGG - Intronic
1128520850 15:68373894-68373916 TGCAGGTACAGTTTGATCCAGGG - Intronic
1129055032 15:72813258-72813280 TTCAGGCATGGCTGGATCCAAGG + Intergenic
1129152090 15:73695751-73695773 TTCAGGCATAGCTGGATCCAGGG + Intronic
1129603300 15:77012541-77012563 CTCAGGTACAACTTGATGGATGG - Intronic
1130849839 15:87782173-87782195 TTCAGGCACAGCTGGAACCAGGG + Intergenic
1130914219 15:88291906-88291928 GTCAGGTACAGCTGGCTCCAGGG - Intergenic
1131783854 15:95890322-95890344 TTCTGGAACTGCTTGATGCAGGG - Intergenic
1132007252 15:98239246-98239268 TTCAGGTATAGCGAGATCCAGGG - Intergenic
1132215317 15:100057877-100057899 TTCAGGCACTGCTGGATCCAGGG - Intronic
1132347436 15:101116745-101116767 TTCAGGTATGGCTCTATCCAGGG + Intergenic
1132411301 15:101579989-101580011 TTCAGGCATAGCTGGACCCAGGG + Intergenic
1133337597 16:5016096-5016118 TTCAGGTAAGGCTAGATCCAGGG + Exonic
1133578019 16:7113088-7113110 TTCAGGCACATGTTGAACCACGG + Intronic
1133661397 16:7921449-7921471 TTAAGGTACAGCTGGATCCAGGG - Intergenic
1134037385 16:11041421-11041443 TTCAGGCAAAGCTGGATCCAGGG + Intronic
1134201915 16:12206253-12206275 TTCAGGGATGGTTTGATCCAGGG + Intronic
1134260816 16:12649536-12649558 TTCAGGTATGGCTAGACCCAGGG + Intergenic
1134276454 16:12780660-12780682 TGCAGGTACAGCTGGATCTAGGG - Intronic
1134340252 16:13338223-13338245 TTCAGGTGTGGCTGGATCCAGGG - Intergenic
1134365027 16:13569178-13569200 TTCAGGTATGGCTGAATCCAGGG - Intergenic
1134366133 16:13580965-13580987 TTCAGGCACGTCTTGATCCAGGG + Intergenic
1134399448 16:13895695-13895717 TTCAGGCATGGCTTGATCTAGGG - Intergenic
1134674014 16:16076703-16076725 TTCAGGTGCGGTGTGATCCAGGG + Intronic
1134907852 16:17996611-17996633 TTCAGGTATGGCTGGATTCAGGG - Intergenic
1135052084 16:19201353-19201375 TTCAGGCACAGCTAAATTCAGGG + Intronic
1135114552 16:19713901-19713923 TTCAGGTATGGCTGGATCTAGGG - Intronic
1135233282 16:20729826-20729848 TTCAAGTACAGCCACATCCAAGG + Intronic
1135293210 16:21257806-21257828 TTCAGCTACAGCTGTATTCAGGG - Intronic
1135502092 16:23005094-23005116 TTCAGGTATAGGTCGATCCAGGG - Intergenic
1135598066 16:23758370-23758392 TTTAGGCACAGCTGGATCCAAGG + Exonic
1135617352 16:23923219-23923241 TTCAGGTATTGTCTGATCCAGGG + Intronic
1135822967 16:25701045-25701067 TTCAGGAAAAACTGGATCCAGGG + Intronic
1135885801 16:26306322-26306344 TTCAGGTACAGCTTGATCCAGGG + Intergenic
1135958795 16:26978808-26978830 TTCAGGCACAGCTGGATCTAAGG + Intergenic
1135978753 16:27129846-27129868 TTCAGGCACAGTTGGATCCAGGG + Intergenic
1136014229 16:27384804-27384826 TTCAGGCATAGCTGGATCAAGGG + Intergenic
1136050407 16:27646185-27646207 TTCAGGTGCAGCTGGATCCAGGG + Intronic
1136132488 16:28232459-28232481 TTCAGGCATAGCCTGATCCAGGG + Intergenic
1136132942 16:28235637-28235659 TTCAGGCATAGCCTGATCCAGGG + Intergenic
1136140181 16:28283350-28283372 TTCAGGCATAGCTGGATCAAGGG + Intergenic
1136246801 16:28980943-28980965 GTCAGGTAAAGCTGGATCCAGGG + Intronic
1137265870 16:46868545-46868567 TTAAGGTACAGCTTGGGCCATGG - Intergenic
1137595009 16:49717609-49717631 TTCAGGTGCAGCTGAATCCAGGG - Intronic
1137667536 16:50260416-50260438 TTCAGGCATGGCTGGATCCAGGG + Intronic
1137715030 16:50593335-50593357 TTCAGGCACCATTTGATCCAGGG + Intronic
1137840855 16:51639691-51639713 TTCAGGTATTGCTGGATCAAGGG + Intergenic
1137868269 16:51923994-51924016 TCCAGGTCCAGCTTGAACAAAGG + Intergenic
1137984150 16:53093757-53093779 GCCAGGTACAACTTGATCTAGGG + Intronic
1138157416 16:54719064-54719086 TTCAGGCATGGCTTGATCCAAGG + Intergenic
1138304878 16:55965451-55965473 TTAAGGTAGATCTTAATCCAAGG - Intergenic
1138447286 16:57072100-57072122 TTCAGGCACAGCTGGATCCAGGG + Intronic
1138519954 16:57565430-57565452 TTCAGACATAGCTGGATCCAGGG + Intronic
1138520238 16:57566920-57566942 TTCAGGCATGGCTTGATCCACGG + Intronic
1139089161 16:63622752-63622774 TTTAAGCACAGCTTGATTCATGG - Intergenic
1139466646 16:67157574-67157596 TTCAGGGACGGCTGGATCCAGGG - Intronic
1140659416 16:77173517-77173539 TTCAGGTGAGGGTTGATCCAGGG - Intergenic
1140848992 16:78916914-78916936 ATCAGGTAAAGCTTGACCCAGGG + Intronic
1140855072 16:78970849-78970871 TTCAGGCACGGCTGGATCCAGGG + Intronic
1141293942 16:82749235-82749257 TTTAGGTACAGCTGGATCCAGGG - Intronic
1141536130 16:84681409-84681431 TTCAGGCATGGCTGGATCCAGGG - Intergenic
1141807174 16:86349474-86349496 TTGAGGTACAGGATGATCCCTGG - Intergenic
1141879253 16:86847011-86847033 TTCAGGTAGGGCTGGATCTAGGG + Intergenic
1141883510 16:86875444-86875466 TTCAGGCAAGACTTGATCCAGGG - Intergenic
1141897440 16:86967569-86967591 TTCAGGTACAACCTGACCCCAGG + Intergenic
1141976565 16:87520149-87520171 TTCAGGCGCAACTGGATCCAGGG + Intergenic
1141988235 16:87593919-87593941 TTCAGGTACTGCTGGATCCAGGG + Intergenic
1142149749 16:88507431-88507453 TTCAGGTGTGGCTTGATCCAGGG + Intronic
1142353509 16:89590610-89590632 CTCAGGCACTGCTGGATCCAGGG + Intronic
1142722545 17:1786331-1786353 TTAAGATACAGCTTGATCCAGGG - Intronic
1142879125 17:2870798-2870820 CTCAGAAACAGCTGGATCCAGGG + Intronic
1143831861 17:9658775-9658797 TTCAGGTAGGGCTGGATCCAGGG + Intronic
1143861625 17:9895476-9895498 TTCAGGTATGGCTTAATCCAGGG - Intergenic
1143933316 17:10454730-10454752 TTGAAATACAGCTTCATCCAGGG + Exonic
1143937740 17:10504985-10505007 TTGAAATACAGCTTCATCCAGGG + Exonic
1144083254 17:11783744-11783766 TTCAGGTACAGGAGGAGCCATGG + Exonic
1144943143 17:18955151-18955173 TTCAGGTGCAGTATGATCCAGGG + Intronic
1146168057 17:30607214-30607236 TTTAGGCACAGCTAGATCCCGGG + Intergenic
1146221028 17:31020711-31020733 TTTAGGCACAGCTGGATCCCGGG + Intergenic
1146287418 17:31583220-31583242 TTCAGGCATGGCTGGATCCAGGG - Intergenic
1146729227 17:35180088-35180110 TTCAGGTGTGGCTTGATGCAGGG + Intronic
1146735645 17:35236549-35236571 TTCAGTTACATTTTGCTCCAGGG - Intergenic
1146931986 17:36784075-36784097 TTCGGGTAAAGTTTGATACAGGG + Intergenic
1147048258 17:37770966-37770988 TTCAGAAACAGTTTGATCCTTGG - Intergenic
1149398892 17:56273889-56273911 TTCAGGTACAGTTTGATTCAGGG + Intronic
1149581412 17:57752939-57752961 TGCAGGTACAGCTTGAGACTGGG - Intergenic
1149999042 17:61420937-61420959 TTCAGGCATAGCTGGTTCCAGGG + Intergenic
1150319739 17:64202519-64202541 TTCATTTGCAGCTTAATCCAGGG - Intronic
1150366725 17:64594424-64594446 TTTAGGCACAGCTGGATCCCGGG - Intronic
1153278006 18:3387455-3387477 TTCAGGAACAGCTGGGTTCATGG - Intergenic
1155233395 18:23795688-23795710 TTCAGGAATAGCTTGATCTAGGG + Intronic
1156022085 18:32611431-32611453 TACATGTACAGCTTGTTACAAGG + Intergenic
1156248959 18:35332425-35332447 TTTAGGCACAGCTGGATCTAGGG + Exonic
1156436161 18:37132347-37132369 TTTTGGTACTGCTTGTTCCAAGG + Intronic
1156642136 18:39115195-39115217 TTCAGTCACAGCTTGATGTAGGG - Intergenic
1158235025 18:55302761-55302783 TCCAGATGCAGCTTTATCCAGGG - Intronic
1158310942 18:56157601-56157623 TTCAGGTACAGCAGGATCTAGGG + Intergenic
1160737578 19:671019-671041 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1160926990 19:1551260-1551282 TTCAGGCACAGCTGGATCCAGGG + Intergenic
1161212230 19:3073211-3073233 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1161316677 19:3620575-3620597 TTCAGGTAAGGCTGGATCCAGGG - Intronic
1161504058 19:4634560-4634582 TTCAGGCACAGTTTGATCAAGGG + Intergenic
1161616378 19:5273079-5273101 TTCAGGTTCAGCTGGATCCAGGG - Intronic
1161623880 19:5314416-5314438 TTCAGGCATAGTTGGATCCAGGG - Intronic
1161859452 19:6787080-6787102 TTCAGGTCTGGCTGGATCCAGGG + Intronic
1162928369 19:13942224-13942246 TTCAGGCACAGCTGGATCCAGGG + Intronic
1162999001 19:14354273-14354295 TTCAGGGACAGCTGGATTCACGG + Intergenic
1163257929 19:16168794-16168816 GTCAGGTACAGCTGGAACCAGGG - Intronic
1163424004 19:17230991-17231013 TTCAGGTATGGCTTGATCTGGGG + Intergenic
1163616014 19:18328812-18328834 TTCAACTATAGCTGGATCCAGGG - Intergenic
1163668894 19:18616238-18616260 TTCAGGCACAGCTGGATCCAGGG + Intronic
1163768517 19:19176964-19176986 GTCAGGTACAGTTGGATCCAGGG + Exonic
1164464356 19:28474994-28475016 TTCAGGCATGGCTGGATCCAGGG + Intergenic
1164472107 19:28545008-28545030 TTAAGATATAGCTTGATCCATGG - Intergenic
1164507914 19:28874601-28874623 TTCAGGTGTGGTTTGATCCAGGG - Intergenic
1164540242 19:29116543-29116565 TTCAGGCAAGGCTGGATCCAGGG - Intergenic
1164589197 19:29496902-29496924 TTCAGGCATGGCTTGATCCAGGG - Intergenic
1164668768 19:30061352-30061374 TGCAGGTGCGGGTTGATCCAGGG + Intergenic
1164720072 19:30425471-30425493 CTCAGGTGCTGTTTGATCCAGGG + Intronic
1164877866 19:31705294-31705316 TTCAGGTAGGGCTGAATCCAGGG + Intergenic
1164916250 19:32054468-32054490 TTCAGGTATAGCTGGATCCAGGG - Intergenic
1164994004 19:32706236-32706258 CTCAGGTACAGCTTTATCCCTGG + Intronic
1165038301 19:33050297-33050319 TTCAGGCCTAGCTTGATCCAGGG - Intronic
1165118344 19:33543132-33543154 TTCAGTTACGGCTGGATCCAGGG + Intergenic
1165700496 19:37933577-37933599 ATCAGGTGCAACATGATCCAAGG + Intronic
1165713113 19:38026131-38026153 TTCAGGCAAGGCTGGATCCAGGG + Intronic
1165766665 19:38355777-38355799 TTCAGGTATGGCTGGATCCAGGG + Intronic
1166228420 19:41411489-41411511 TTGGGGCACAGCTAGATCCAGGG + Intronic
1166662819 19:44658266-44658288 TTCAGGTATGGTTAGATCCAGGG + Intronic
1167215551 19:48162092-48162114 TGCAGGCACAGCTGGATCCAGGG - Intronic
1167745829 19:51351359-51351381 TTCAGGCACAGCTTGATCCAGGG - Intronic
1168244823 19:55107052-55107074 TCTAGGCATAGCTTGATCCAGGG - Intronic
925696724 2:6587966-6587988 TTCAATTATAGCTGGATCCAGGG + Intergenic
926173723 2:10570380-10570402 CTCAGGAACACCTAGATCCATGG - Intergenic
926357709 2:12056574-12056596 TTCAGGTACAGAATGGACCATGG - Intergenic
927081113 2:19631472-19631494 TTCAGGAACAGCTGGAACCAGGG - Intergenic
927790494 2:26005818-26005840 TTCAGGCACAGCTGGATCTAAGG + Intergenic
928364159 2:30688982-30689004 TTCAGGCACAGCTGGCACCATGG + Intergenic
928594784 2:32849504-32849526 TTCATGCACATCTGGATCCAGGG + Intergenic
928648217 2:33377437-33377459 TTCTTGTACAGCTTGAGCCTTGG + Intronic
929237173 2:39617757-39617779 TTTAGGTACAGCTGGATCCAGGG - Intergenic
929981718 2:46687514-46687536 TTGAGGTGAAGCTTGATCTAGGG + Intergenic
930866416 2:56126441-56126463 TCCAGGAATAGCTGGATCCAGGG - Intergenic
931233127 2:60390943-60390965 TACAGGAACAGCTGGATCCAGGG - Intergenic
931331601 2:61291526-61291548 TTCAGTCACAGCTGAATCCAGGG - Intronic
932534080 2:72573239-72573261 TTCAGGTACTGTATTATCCAAGG + Intronic
933479957 2:82843804-82843826 TTCATGTACAACATGATCCCAGG - Intergenic
935340554 2:102056256-102056278 TTCAGGCATGGCTAGATCCAAGG + Intergenic
936627768 2:114166643-114166665 TTAAAGTACAGCTCCATCCAGGG - Intergenic
937450642 2:121999746-121999768 TTCAGGTGAAGCTTGATCTAGGG + Intergenic
937518752 2:122685574-122685596 TCAAGGTACAGCTCGCTCCATGG - Intergenic
937584480 2:123529993-123530015 TTTAAGTACTGCTTGATCCAGGG + Intergenic
938940788 2:136167989-136168011 TTCAGGCACAGCCTGCTGCAGGG - Intergenic
939225000 2:139353769-139353791 CCAAGGTACAGCTTGAGCCATGG + Intergenic
941106013 2:161354122-161354144 TTCAGGTTCTGCTTGATTCTGGG + Intronic
944346663 2:198674139-198674161 AACAGGTACATCTTGATCCAAGG - Intergenic
945769784 2:214029119-214029141 TTAAGATACAGCTAGAACCAAGG + Intronic
946048271 2:216839181-216839203 TTCAGGTATAGCTTGACCAATGG - Intergenic
946302983 2:218835852-218835874 TTCAGGTACAGTTTGATCCAAGG - Intergenic
946309601 2:218875952-218875974 TTCAGGTACAGCTGAACCCAGGG + Intergenic
947577789 2:231290424-231290446 TTCAGGCACAGTTTGATCAGGGG + Intronic
947923748 2:233902834-233902856 TTCAGCAGCAGCTTGATCAAGGG - Intergenic
1168730562 20:75644-75666 TTCAGGTACAATAAGATCCAAGG + Intergenic
1168977233 20:1976117-1976139 TTCAGGTAGAGTTTGATCAAAGG - Intergenic
1168977352 20:1977291-1977313 TTCAGGTAGAGTTTGATCAAGGG - Intergenic
1169190731 20:3657773-3657795 TTCAGGCACAGCTGTCTCCAGGG - Intergenic
1169202650 20:3720257-3720279 TTCAGGTAAGGCTTGATCCAGGG - Intergenic
1169860486 20:10146316-10146338 TTCAGGTATGGCTGGATCCAGGG - Intergenic
1170255796 20:14341814-14341836 TTCAGGTAAAGCTTGATACATGG + Intronic
1170634579 20:18093293-18093315 TTGAAGCACAGCTTGATTCAGGG - Intergenic
1171018370 20:21561991-21562013 TTCAGGTTTGGCTGGATCCAGGG + Intergenic
1172058005 20:32167661-32167683 TTCAGGTCTGGCTGGATCCAGGG + Intergenic
1172885441 20:38227920-38227942 TTCAAGTATGGCCTGATCCAAGG - Intronic
1173045911 20:39511736-39511758 CTCAGGTATAGCTAGATTCAGGG - Intergenic
1173293012 20:41730792-41730814 TTCAAGATCAGCTTGATCTAGGG - Intergenic
1173396778 20:42687649-42687671 TTCAGGAGCACCTTGTTCCAGGG + Intronic
1173460730 20:43241264-43241286 TTCAGGCATGGCTTGATCCAGGG - Intergenic
1173699268 20:45053390-45053412 TTCGGAGACTGCTTGATCCATGG + Intronic
1173914537 20:46697142-46697164 TTTAGGTGCAGCTGGACCCAGGG + Intergenic
1173916805 20:46714120-46714142 TTCAGGTGCAGTTGGATCTAGGG + Intronic
1173917741 20:46721621-46721643 TTCAGGCACTGCTAGATCCATGG + Intronic
1173944446 20:46939463-46939485 TTCAGACATAGCTTGATCAAGGG - Intronic
1174104266 20:48151034-48151056 CTCAGATGCAGCTGGATCCAGGG - Intergenic
1174107765 20:48175003-48175025 TTCAGGTATAGGTAGATCCAGGG - Intergenic
1174113668 20:48212990-48213012 TTCAGGCACAGCTGCATCCAGGG + Intergenic
1174115029 20:48220985-48221007 GTCAGGTAGAGCTTGATCTAGGG + Intergenic
1174127280 20:48316022-48316044 TCCAGGTACAGGTGGATCTAGGG - Intergenic
1174168187 20:48599551-48599573 TTCAGGCACAGCTGCATCCAGGG - Intergenic
1174187498 20:48716956-48716978 TTCAGGCATAGCTGCATCCAGGG - Intronic
1174198251 20:48788561-48788583 TTCAGGTAGAGTTTGATCTAGGG - Intronic
1174267756 20:49344329-49344351 TTCAGGTATGGCTGGATCCAGGG + Intergenic
1174268623 20:49350509-49350531 TTCAGGTGTGGCTGGATCCAGGG - Intergenic
1174327250 20:49789255-49789277 TTCAGGTACAGCTGGATTCAGGG - Intergenic
1174435414 20:50503092-50503114 TTCAGGCACCGCCAGATCCAGGG - Intergenic
1174502362 20:50995020-50995042 TTCAGGAACTGCTGGATCTAGGG + Intergenic
1174515071 20:51085737-51085759 TTCAGGTATGGCTGGATCCAGGG + Intergenic
1175033410 20:55976952-55976974 TTCAGGTAAGGCTAGATCCAGGG - Intergenic
1175117590 20:56694049-56694071 TTCAGGCACAGATGGATCTAGGG + Intergenic
1175122323 20:56725277-56725299 TTCAGGCACGGCTGGATCCAGGG + Intergenic
1175134427 20:56812290-56812312 TTCAGGCATGGCTGGATCCAGGG + Intergenic
1175228461 20:57459164-57459186 TTCAGGCACAGATGGATCCAGGG + Intergenic
1175649374 20:60704711-60704733 ATCAGGTTCAGCATGTTCCAGGG - Intergenic
1175678132 20:60964878-60964900 TTCAGGAACACCTGGACCCAGGG + Intergenic
1178976253 21:37223723-37223745 TTTAGGCACTGCTTTATCCAGGG - Exonic
1179288688 21:39999612-39999634 TTCAGGAGCAGCTGGATGCAGGG - Intergenic
1180037140 21:45255842-45255864 CTCAGGCACGGCTGGATCCAGGG - Intergenic
1181726751 22:24816710-24816732 TTCAGGTGCACCTATATCCAGGG + Intronic
1181822064 22:25484126-25484148 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1181822204 22:25485105-25485127 TTCAGGTATGGCTTGATCCAGGG - Intergenic
1181953633 22:26572420-26572442 CTCAGGTATGGCTAGATCCAAGG - Intronic
1182323994 22:29497805-29497827 TTCAGGAATGGCTGGATCCAGGG + Intergenic
1182533230 22:30978763-30978785 TTCAGGCACGGTTGGATCCAGGG - Intergenic
1182884173 22:33759150-33759172 TTCAGGCAGAGTTGGATCCAGGG - Intronic
1183077756 22:35437509-35437531 TTCAGGCTTAGCTGGATCCAGGG - Intergenic
1183261736 22:36799808-36799830 TTCAGGAACAGCTGGATCAAGGG - Intergenic
949583121 3:5410976-5410998 TTCAGGAATAGCTGGGTCCAGGG - Intergenic
949638056 3:6005908-6005930 TTCTGGTACAGCTGGATTTAGGG - Intergenic
949843857 3:8351015-8351037 TTCAGGTATGGCTGGATCCAGGG - Intergenic
949922344 3:9013016-9013038 TTCAGGTATAGCTTGATCCAGGG - Intronic
950047813 3:9960878-9960900 TTCAGGCACAGCTGGGTCCAGGG - Intergenic
950132760 3:10558577-10558599 TTCAGGCACAGCTGGATCCAGGG - Intronic
950192902 3:10990634-10990656 TTCAGGTATGGCTGGATCCAGGG + Intergenic
950221095 3:11196756-11196778 TTCAGCTAAAGTGTGATCCATGG + Intronic
950441035 3:13010593-13010615 TTCAGGTACAGTTGGATTCGGGG - Intronic
950471393 3:13188837-13188859 TTCAGGCATGGCTGGATCCAAGG - Intergenic
950575256 3:13828376-13828398 TTCAGGTCTGGCTTGATCCAGGG - Intronic
950686832 3:14624548-14624570 TTCAGGTATAGCTAGATCTAGGG - Intergenic
951801532 3:26602085-26602107 TTCATGTTCATTTTGATCCAGGG - Intergenic
952532050 3:34272931-34272953 TTCAGGTTCATCTTGATTCAGGG + Intergenic
952755532 3:36862852-36862874 TTCAAGTACAGCTGGCTTCAGGG - Intronic
952814368 3:37434470-37434492 TTCAGGCACAGCTCAATCCAGGG - Intronic
953481722 3:43257756-43257778 TTCAGGTCTAGATTGCTCCAGGG - Intergenic
953706917 3:45238109-45238131 TTCAAGTCCAGCTGGATCTAGGG - Intergenic
954030717 3:47818137-47818159 TCCAGCAACAGCTTGGTCCAGGG + Intronic
954855713 3:53642107-53642129 TTCAGGCTCAACTTGATCCAGGG + Intronic
955003538 3:54948970-54948992 TTCAGGTACAGTTGGATCTGGGG + Intronic
955352002 3:58200493-58200515 TTCAGGCATAGCTGGATCCAGGG - Intronic
955409179 3:58644855-58644877 TTCAGGACCACCTGGATCCAGGG - Intronic
955515070 3:59718323-59718345 CTCAGGTGTAGCTGGATCCAGGG + Intergenic
955522800 3:59791471-59791493 TTCAGGCGCGGCTGGATCCAGGG - Intronic
955527155 3:59832910-59832932 TTCAGGCACAGCTGGATTCAGGG - Intronic
955542436 3:59991880-59991902 TTCAGGTATGGCTTGATCCAGGG - Intronic
955674922 3:61438069-61438091 TTCAGGTATAGCTGAGTCCAGGG - Intergenic
955686784 3:61557416-61557438 TTCAGGTATGACTTGATTCAAGG + Intergenic
955957902 3:64309380-64309402 TTCAGGCACAACTAGATCTATGG - Intronic
956306394 3:67831546-67831568 ACAAGGTACAGCTTGATCCGTGG + Intergenic
956380953 3:68663915-68663937 TTCAGGAATAGCTGAATCCAGGG - Intergenic
956722886 3:72133819-72133841 TTCAGGTATAGCTGGATCCAGGG + Intergenic
957630538 3:82711324-82711346 TCAAGGTACAGCTTGGTTCATGG - Intergenic
958110560 3:89138082-89138104 TTCAGCTGCTGCTTGATTCAGGG + Intronic
960259479 3:115550141-115550163 TTTAGGTACGGTTTGACCCAAGG + Intergenic
960403094 3:117227943-117227965 TTCAGGCACAGCTCAATTCAGGG + Intergenic
960703297 3:120458146-120458168 ATCAGGTACAGCTTGATTTGAGG - Intergenic
961368073 3:126413940-126413962 TTTAGGCACAGCTGGATCCAGGG + Intronic
961541073 3:127599660-127599682 TTTGAGCACAGCTTGATCCAGGG + Intronic
961619871 3:128215692-128215714 TTTAAGCACAGCTGGATCCAGGG + Intronic
961651059 3:128416859-128416881 TCCAGGCATAGCTGGATCCAGGG - Intergenic
961741286 3:129034581-129034603 TTCAGGCACAGCTGGGTCCAGGG + Intronic
961938250 3:130609228-130609250 TCCAGGGAGAGCTTGAGCCAAGG + Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963055676 3:141184653-141184675 TTTAGGTACAGCTAGATCCCAGG + Intergenic
963369559 3:144381264-144381286 TTGTGGTACAGTTTGATCCAAGG - Intergenic
967633860 3:191778191-191778213 TCAAGGTACAGCTTGGGCCATGG + Intergenic
967716269 3:192765517-192765539 TTCAGGAACAGCTGGAATCAGGG + Intronic
969245151 4:5927151-5927173 TCCAGGCACAGCTGGCTCCAGGG - Intronic
969298501 4:6283453-6283475 TTCAGGCACGGCTGGATCCAGGG + Intronic
969447046 4:7251203-7251225 TTCAGGTGTGGCTTGTTCCAGGG + Intronic
969805078 4:9601076-9601098 ATCAGGCACAGCTCGATCCGAGG + Intergenic
970523364 4:16907904-16907926 TTCAGGTTCAGTAGGATCCAGGG + Intergenic
971217251 4:24672887-24672909 TTCAGGTACAACCTGACCCATGG - Intergenic
971370112 4:26012152-26012174 TTCAGGCACAGCTCAATCCAGGG - Intergenic
971948670 4:33315271-33315293 CCAAGGTACAGCTTGAGCCATGG + Intergenic
973122841 4:46544069-46544091 TTCAGGTGCAGCTTTTTCTAAGG + Intergenic
973603851 4:52567646-52567668 TTCAAGTACAGTTTGACTCAGGG - Intergenic
973845217 4:54904891-54904913 TTCAGATCCAGCTTGGTTCAGGG + Intergenic
973932558 4:55807679-55807701 TTCAGGCATGGCTGGATCCAAGG + Intergenic
975856201 4:78627269-78627291 TTTAGGCACAGCTGGATTCAGGG + Intergenic
975954418 4:79820840-79820862 TTCAGGGCCTGCTTGAGCCATGG + Intergenic
975971761 4:80047817-80047839 CTCAGGTACAGCTGGATCCAAGG - Intronic
976258499 4:83123697-83123719 TTCAGCTCCAGATTGCTCCATGG + Intronic
976832223 4:89328408-89328430 TTCAGGCACAGGTTGATCCAGGG + Intergenic
978962498 4:114699994-114700016 ATCAGGTGCAGCTGGATCCAGGG - Intergenic
979240238 4:118441320-118441342 TTCAGGCATGGCTTGATCCAGGG + Intergenic
979645281 4:123060530-123060552 TCAAGGTACAGCTTGGGCCATGG - Intronic
980079338 4:128327406-128327428 CTTAGGTCCAGCTGGATCCAAGG - Intergenic
981035608 4:140165423-140165445 TTTAGGCTCAGCTGGATCCAGGG - Intergenic
981177105 4:141694401-141694423 TCCAGGTACAGTCTGATGCAGGG + Intronic
983309204 4:166035860-166035882 TTCAGGCAGAATTTGATCCATGG + Intronic
985334667 4:188878852-188878874 TTCAGTTACAGCTACATCCTAGG + Intergenic
985417689 4:189753376-189753398 TCAAGGTACAGCTTGGGCCATGG + Intergenic
986559353 5:9045210-9045232 TTCAAGTGCAGCCTAATCCATGG + Intronic
986757589 5:10852659-10852681 TTCAGGTACAGCTTGATCCAGGG - Intergenic
989414614 5:41159277-41159299 TTCAGCTGCACCATGATCCATGG - Intronic
989509893 5:42273902-42273924 GTCAGGTTCAGCATGTTCCAGGG + Intergenic
991233200 5:64361080-64361102 TGCAGGCACACATTGATCCATGG + Intronic
991582636 5:68172794-68172816 TTAAGGTATAGCTGGATGCATGG - Intergenic
992174141 5:74133261-74133283 TTCAGGTAAAGCTGGATTCAAGG + Intergenic
992358027 5:76005804-76005826 TTCAGGTTCAGCTGGATCCAGGG - Intergenic
992385894 5:76284527-76284549 TTGAGGCACAGGTGGATCCAGGG - Intronic
993018488 5:82563569-82563591 TTCAGGTACAGGAAAATCCAAGG + Intergenic
993225908 5:85167129-85167151 CTAAGGTACAGCTTGAGCCATGG + Intergenic
993542675 5:89171996-89172018 TTCAGGTGTAGCTTGATTCAGGG + Intergenic
994464385 5:100108733-100108755 CTCAGGTACTGCCTGAGCCATGG + Intergenic
995230478 5:109755839-109755861 TTCAGGTATTGCTGTATCCAGGG + Intronic
996368725 5:122730544-122730566 TTCAGGCATAACTTGATTCAGGG + Intergenic
996874336 5:128224779-128224801 TTCAGGTCAAGCTTGATGGATGG - Intergenic
997178472 5:131803357-131803379 TTCAGGCACAGCTTTATCCAAGG + Intergenic
997516682 5:134495013-134495035 TTCAGGCACAGTTTGATCCAGGG - Intergenic
997892031 5:137685737-137685759 TTCATGTGTAGCTTGAGCCACGG - Intronic
998065910 5:139158511-139158533 TTCAGGTACTGCTAAATCCGAGG - Intronic
998650047 5:144108403-144108425 TTCAGTTACAGCTCCATCCTAGG - Intergenic
999038121 5:148376244-148376266 TTCAGGCACAGCTTTATCCATGG + Intergenic
999145913 5:149393753-149393775 TTTAGGTATGGCTGGATCCAGGG - Intronic
999254050 5:150199758-150199780 TTCAGGCACAGCTGGGTCTAGGG + Intronic
1000145299 5:158447865-158447887 ATCAGGTACTGCTTGATCCGGGG - Intergenic
1000269135 5:159666598-159666620 TTCAGACACGGCTGGATCCAAGG - Intergenic
1000303300 5:159974127-159974149 GTCAGGTATGGCTGGATCCAGGG + Intergenic
1000691728 5:164330986-164331008 TTCAGGTGGAGCTTTATTCAGGG - Intergenic
1000810410 5:165854498-165854520 TTCAGGCACAGCTAGATCCAGGG - Intergenic
1001050662 5:168411525-168411547 TTCAGGCACAGCTGGATCCAGGG + Intronic
1001146624 5:169190373-169190395 TTCAGGAACAGCTGGATCCAGGG - Intronic
1001182578 5:169534304-169534326 ATCAGGTACAGTGTGATCCAGGG - Intergenic
1001253416 5:170165841-170165863 TTCAGGTTCGGCTAGATCCAGGG + Intergenic
1001416730 5:171550228-171550250 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1001436598 5:171704154-171704176 TTCAGGCATGGCTGGATCCAGGG - Intergenic
1001438893 5:171723047-171723069 TTCAGGCACGGCTGGATCCAAGG + Intergenic
1001442768 5:171757933-171757955 TTCAGGAATAGCTTGATCTAGGG + Intergenic
1001524766 5:172420930-172420952 TTCAGGCACATCTTAATCCAGGG - Intronic
1002080630 5:176735199-176735221 TTCAGGCCCAGCTGGATCCAGGG - Intergenic
1002467638 5:179415743-179415765 TTCAAGTACAGCTGGATTTACGG + Intergenic
1002740490 5:181431903-181431925 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1005909489 6:30295709-30295731 CTCAGGTACAACTGGAACCAGGG + Intergenic
1005944273 6:30584279-30584301 TTCAGGGACAGCTGGAACAAGGG + Exonic
1006172166 6:32099564-32099586 TTCAAGTCCAGCTTCAACCAGGG - Intronic
1007124181 6:39411129-39411151 TTCAGGTACAGCTGGGACCAGGG + Intronic
1007219463 6:40267017-40267039 TTCAGGCATGGTTTGATCCAGGG - Intergenic
1007241662 6:40431022-40431044 TTCAGGTTCAGCTGGATCAAAGG - Intronic
1008045322 6:46845767-46845789 TTCAGGTACAGCTAGATTCAAGG - Intergenic
1010156095 6:72794967-72794989 TTCAGGCATAGCTAGATACAAGG + Intronic
1012589100 6:100957807-100957829 TTAAGGTTCAGATTGATCCAAGG + Intergenic
1017739905 6:157397751-157397773 TTCAAGTCCAGCTTCATACAGGG - Intronic
1017970090 6:159304517-159304539 TTCAGGCATAGCTGGACCCAAGG - Intergenic
1018262462 6:161984210-161984232 ATCAGGCATAGCTGGATCCAGGG - Intronic
1018389739 6:163332786-163332808 CTCAGGTACAACGTGATCAAGGG + Intergenic
1018469299 6:164081980-164082002 ATCAGGCACAGGTTGATTCAGGG + Intergenic
1019245600 6:170707504-170707526 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1019356903 7:585006-585028 TTCAGGCACGGCTGGATCCAGGG - Intronic
1019495746 7:1339788-1339810 TTCAGGCATGGCTTGATCCAGGG - Intergenic
1020077828 7:5270182-5270204 GTCAGGTAAGGCTAGATCCAGGG + Intergenic
1020254390 7:6494551-6494573 TTCAGGTATGGCTGGATCCAGGG + Intergenic
1023123943 7:36936379-36936401 TTCAGGGCCAGCGTAATCCAGGG - Intronic
1023545905 7:41317544-41317566 TTTAGGCACAGCTTGGTGCAGGG + Intergenic
1025201058 7:56961989-56962011 GTCAGGTAAGGCTAGATCCAGGG - Intergenic
1025213230 7:57033277-57033299 TTCAGGCACGGCTGCATCCAGGG + Intergenic
1025658723 7:63543547-63543569 TTCAGGCACGGCTGCATCCAGGG - Intergenic
1025670886 7:63614943-63614965 GTCAGGTAAGGCTAGATCCAGGG + Intergenic
1026115217 7:67490216-67490238 TTCAGGTACGGTTCGATCTAGGG + Intergenic
1026558570 7:71428983-71429005 TTCAGGTACAGTTTGCTTCTGGG + Intronic
1027934728 7:84588226-84588248 TTCAGGTACATCCTGTACCAAGG + Intergenic
1028102684 7:86840309-86840331 TTAATTTACAGATTGATCCATGG - Intronic
1028387397 7:90272648-90272670 TTCATGTGCAGCTTTATTCAGGG + Intronic
1028878785 7:95855448-95855470 TCCAGGTACAGGATGATCAATGG - Intronic
1030171220 7:106604787-106604809 TTCAGTTAAAGCATGTTCCAGGG - Intergenic
1030360419 7:108589763-108589785 TTCAGGCACAGCTGGACCTAGGG - Intergenic
1031476092 7:122223471-122223493 TACAGGTACAGCTGAATTCAGGG + Intergenic
1031605886 7:123767393-123767415 TTCAGGCTTAGCTGGATCCAGGG + Intergenic
1031860129 7:126969857-126969879 TTAAGTTACTCCTTGATCCATGG + Intronic
1032478621 7:132228931-132228953 TGCAGGTGCATCTTGAGCCATGG - Intronic
1032897987 7:136273589-136273611 TTTTGGCACAACTTGATCCAGGG + Intergenic
1033275153 7:139966427-139966449 TTCAGGTATGGCTTGATTCAGGG + Intronic
1033420201 7:141198804-141198826 TCCAGGTACAGTTTCAGCCAGGG - Intronic
1034168830 7:149046984-149047006 TTCAGGCGTAGCTTAATCCAGGG + Intergenic
1035502524 8:100698-100720 TTCAGGCGTGGCTTGATCCAGGG - Intergenic
1035519358 8:264856-264878 TTTATGGACAGCTTGACCCAAGG + Intergenic
1035821629 8:2598996-2599018 TTCATGTCCAGCTGGAACCATGG + Intergenic
1038818882 8:30933992-30934014 TTCAGGTACTGCATGCTCCCTGG + Intergenic
1039696073 8:39913230-39913252 GTCAGGTACAGTTAGATGCAAGG + Intronic
1042385475 8:68169055-68169077 TTCAGGCACAGCTCTATCCAGGG + Intronic
1042854684 8:73254562-73254584 TCCAGATGCAGCTTTATCCAGGG + Intronic
1043375434 8:79644245-79644267 ATCAGGAACAGCTGGATCCAGGG + Intronic
1043834504 8:85031660-85031682 TTCAGGTAAGGGTGGATCCAAGG - Intergenic
1044273621 8:90275219-90275241 TCAAGGTACAGCTTGGGCCATGG + Intergenic
1044871866 8:96627655-96627677 TTCAGGCACAGCTGGATCTTGGG + Intergenic
1044932351 8:97261995-97262017 TTCAGATACGACTTGATCCAGGG - Intergenic
1046005393 8:108475548-108475570 TTTATATACAGCTTGATCCAAGG + Intronic
1047728955 8:127709994-127710016 TTCAGGTACAGTTGGATCAAGGG - Intergenic
1048012380 8:130468432-130468454 TTCACGTTGAGCTTGATGCAGGG + Intergenic
1048066847 8:130978966-130978988 TTCAGGCACAGCTTGGTCCAGGG - Intronic
1048131893 8:131706755-131706777 TTCAGGTATGGCCTGATCTAGGG + Intergenic
1048491204 8:134895521-134895543 TCCAGGTAAGGCTGGATCCAGGG + Intergenic
1048491715 8:134900468-134900490 TTCAGGCACAGCTAGATCCAGGG + Intergenic
1049237766 8:141520938-141520960 TTCAGGGAAGGTTTGATCCAGGG + Intergenic
1049256756 8:141618286-141618308 TTTAGGTATGGCTGGATCCAGGG + Intergenic
1049756527 8:144313484-144313506 TTCAGGTACCGCCTTATCCCGGG + Intronic
1050365138 9:4867171-4867193 TTCAGGTAAAGCTGGATCTAGGG + Intronic
1050698844 9:8313461-8313483 TTCAGGCATAACTTGATTCAGGG - Intergenic
1051437349 9:17047232-17047254 TTCAGGCATAGCTGGATCCAGGG + Intergenic
1052273959 9:26657354-26657376 TTCAGGCACCACTGGATCCAGGG + Intergenic
1052866635 9:33468128-33468150 TCCAGGTACAGCATGAGGCACGG - Exonic
1054883716 9:70173028-70173050 TTCAGGCACAGCTTGATGCAGGG + Intronic
1055754413 9:79542637-79542659 TTCAGGCAAGGTTTGATCCAGGG - Intergenic
1056225484 9:84490853-84490875 TTCAGGTAAACCATAATCCAGGG - Intergenic
1056270167 9:84939794-84939816 TTCAGGCACCACTAGATCCAGGG + Intronic
1056774769 9:89503211-89503233 TCCAGGTACAGTTAGATCCAGGG + Intergenic
1057479712 9:95434979-95435001 TTTGGGTACAGCTTGACCCGGGG + Intergenic
1058292240 9:103257008-103257030 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1058727208 9:107815696-107815718 TTTAGGTGCAGCTGGATTCAGGG + Intergenic
1059976310 9:119721589-119721611 TTCAGGAACAACTGCATCCAGGG + Intergenic
1060108330 9:120888791-120888813 TGCAGGCACAGTCTGATCCAGGG + Intronic
1060358302 9:122931346-122931368 TGCAGGTCCCGGTTGATCCAGGG + Intronic
1060395876 9:123316138-123316160 TTCAGGTATGGCTGGATCTAGGG + Intergenic
1060561040 9:124543738-124543760 TTCAGGAACAGCTGGAGCCCTGG + Intronic
1061362091 9:130150057-130150079 TTCAGGCAAGGCTTGATCCAGGG - Intergenic
1061744935 9:132732732-132732754 TACAGGCACAGCTTGAACCAGGG - Intronic
1203605799 Un_KI270748v1:56711-56733 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1185746039 X:2574288-2574310 TTGTGGTACATTTTGATCCAGGG - Intergenic
1187561470 X:20407411-20407433 TTCAGGCATGGCTGGATCCAGGG - Intergenic
1188731185 X:33648098-33648120 CCAAGGTACAGCTTGAGCCATGG - Intergenic
1189028842 X:37428982-37429004 CTAAGGTACAGCTTGGCCCATGG - Intronic
1189167198 X:38871857-38871879 TTTAGGTAAGGCTTGATCCAGGG + Intergenic
1189288623 X:39869576-39869598 TTCAGGTATGGCTTCATCTAGGG - Intergenic
1189308020 X:40001923-40001945 TTCAGGTTCAACTGGATCCAGGG + Intergenic
1189535348 X:41929393-41929415 TTCAGGTGAGGCTTGATCAAGGG + Intergenic
1190364208 X:49676419-49676441 TGGGGGTACAGCTGGATCCAGGG + Intergenic
1192049507 X:67711123-67711145 TTCAGGCAGAGCTGGATCCAAGG + Intronic
1194707987 X:97199469-97199491 TTTATGTAAAGCTTGATCCAGGG + Intronic
1194726462 X:97403751-97403773 TTCAGGTACACCTAGAGGCAGGG - Intronic
1195154533 X:102109945-102109967 CTAAGGTACAGCTTGGGCCATGG + Intergenic
1196458814 X:115908959-115908981 TTCAGGTAGAGCTTCCTCGAAGG + Intergenic
1196668473 X:118341559-118341581 TTCAGGTATGGCTGGATCCAGGG - Intergenic
1197023483 X:121718208-121718230 TCAAGATACAGCTTGAGCCACGG - Intergenic
1197137120 X:123074436-123074458 CTCAGGGACAGCTTCATGCAGGG + Intergenic
1197330884 X:125152967-125152989 TTCAGTTACCGCTTGTTTCAAGG + Intergenic
1202019809 Y:20452629-20452651 AAAAGGTACAGCTTGATCCATGG + Intergenic
1202387973 Y:24343149-24343171 TTCAGGCATGGCTTGATCCAGGG + Intergenic
1202482814 Y:25326979-25327001 TTCAGGCATGGCTTGATCCAGGG - Intergenic