ID: 1080417926

View in Genome Browser
Species Human (GRCh38)
Location 11:32086927-32086949
Sequence GTGACCTGGCAACTCTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080417921_1080417926 10 Left 1080417921 11:32086894-32086916 CCAGGATCCATCTTAGTTCTCCC 0: 1
1: 0
2: 1
3: 4
4: 119
Right 1080417926 11:32086927-32086949 GTGACCTGGCAACTCTGCCAAGG 0: 1
1: 0
2: 0
3: 19
4: 143
1080417924_1080417926 -10 Left 1080417924 11:32086914-32086936 CCCTCTCTGCACAGTGACCTGGC 0: 1
1: 0
2: 0
3: 22
4: 305
Right 1080417926 11:32086927-32086949 GTGACCTGGCAACTCTGCCAAGG 0: 1
1: 0
2: 0
3: 19
4: 143
1080417922_1080417926 3 Left 1080417922 11:32086901-32086923 CCATCTTAGTTCTCCCTCTCTGC 0: 1
1: 1
2: 4
3: 46
4: 513
Right 1080417926 11:32086927-32086949 GTGACCTGGCAACTCTGCCAAGG 0: 1
1: 0
2: 0
3: 19
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080417926 Original CRISPR GTGACCTGGCAACTCTGCCA AGG Intronic
903597589 1:24507477-24507499 GTGAGCGGGAAACTATGCCAGGG + Intronic
903649839 1:24915835-24915857 GACACCTGGCAAGTCTGGCATGG - Intronic
903698847 1:25231287-25231309 GTGACCTGACAGCTAGGCCATGG - Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905930011 1:41780277-41780299 GGGCCTTGGCCACTCTGCCAAGG + Intronic
906933578 1:50192316-50192338 GGGACCTGGCATGTCTGTCATGG + Intronic
907954735 1:59217324-59217346 GAGGCCAGGCCACTCTGCCATGG + Intergenic
909124542 1:71649749-71649771 GAGACTAGGAAACTCTGCCAGGG - Intronic
914976537 1:152368944-152368966 GTGACCTGGAAACTTTCCCCAGG - Intergenic
916192619 1:162193945-162193967 GTAAGCTGGCAGCTCTGCCTTGG - Intronic
917138071 1:171806914-171806936 ATGACCTGGGAACTCTCTCAAGG + Intronic
919843453 1:201626163-201626185 CTGCCATGGCAGCTCTGCCAAGG + Intronic
922779696 1:228241516-228241538 GTGACCTGGTGGCTCTGCTAGGG - Intronic
924946306 1:248849219-248849241 GTGACTGGCCACCTCTGCCAGGG - Exonic
1072490028 10:95896089-95896111 ATGACCTGGAAACTCTCTCAAGG + Intronic
1073797854 10:107007446-107007468 GTTGCCTGGAAACTCAGCCAGGG - Intronic
1075481995 10:122789851-122789873 GTGTCCTGGCAAATGTGCCATGG - Intergenic
1076114861 10:127888245-127888267 GTGGCCTGGTAGCTCTCCCAGGG + Intronic
1076384038 10:130044544-130044566 GTGAGCTGGTCACTCTGCTAAGG + Intergenic
1076769930 10:132657308-132657330 GTGACCTGCAAGCACTGCCATGG + Intronic
1077110071 11:858419-858441 GTCCCCTGGCACTTCTGCCACGG + Intronic
1079507496 11:21169854-21169876 GTGACATGGCAACTCTTCCTGGG - Intronic
1080417926 11:32086927-32086949 GTGACCTGGCAACTCTGCCAAGG + Intronic
1082815044 11:57502216-57502238 GTCACTTGGCAGCACTGCCAAGG + Intronic
1083185774 11:61017157-61017179 GTGACCTGGCAGCTCTGGGCAGG - Intronic
1083299728 11:61734149-61734171 CTGCCCTGGCAGCTCTGCCTGGG - Intronic
1084649689 11:70481941-70481963 GTGCCCTGGCAACTCCGTCCTGG + Intronic
1085566727 11:77520898-77520920 GAGTCCTGGCAACTGTGACAGGG + Intronic
1087931234 11:103980509-103980531 TTGTCCTGCCAACACTGCCAGGG + Intronic
1090489271 11:127143853-127143875 CTGATCTGCCATCTCTGCCAGGG + Intergenic
1091078085 11:132640107-132640129 CTGGCAGGGCAACTCTGCCAGGG - Intronic
1095347973 12:41174761-41174783 ATGACCCGGCAACTCTCCCCTGG - Intergenic
1096180051 12:49545715-49545737 GACACCTGGTGACTCTGCCAAGG - Intronic
1098119191 12:67217822-67217844 ATGACCTAGAAACTCTCCCAGGG - Intergenic
1100885661 12:99067068-99067090 GTGCCCTGGCCAGTCTCCCATGG + Intronic
1101275982 12:103202036-103202058 GTAACCTAGTAACTCTACCAGGG + Intergenic
1105042423 12:132970879-132970901 ATGACCTAACACCTCTGCCAAGG - Intergenic
1106899573 13:34340952-34340974 ATGACCTTGCCATTCTGCCAAGG + Intergenic
1108030883 13:46228358-46228380 CTGACCTTGCAGATCTGCCAAGG + Intronic
1109991542 13:70064820-70064842 GTGCCCAGGCAACTGTGCCAAGG - Intronic
1110551918 13:76820269-76820291 GAGACCTGGCACCTCTCCCCAGG - Intergenic
1112110116 13:96287026-96287048 GTGCCCTGGCATTGCTGCCATGG - Intronic
1114059553 14:19006957-19006979 GCAACCAGTCAACTCTGCCACGG - Intergenic
1114102993 14:19394794-19394816 GCAACCAGTCAACTCTGCCACGG + Intergenic
1114615828 14:24067909-24067931 GTGCCCTGGGGGCTCTGCCAAGG - Intronic
1115961617 14:38839849-38839871 GTGTCCTGGTAACTGTGCAAAGG + Intergenic
1118772198 14:68949516-68949538 CTGACCTGTCAACACTGCCCAGG + Intronic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1121660743 14:95633161-95633183 TTGCCCTGGGGACTCTGCCAAGG - Intergenic
1122277956 14:100604913-100604935 GTGAGCTGGCAACGCTGGCAAGG - Intergenic
1122718397 14:103708493-103708515 GGGCCCTGGCATCTCTGCCAGGG - Intronic
1122999573 14:105286095-105286117 GTGTCCTGCAGACTCTGCCAGGG - Intronic
1128541928 15:68541986-68542008 GTGGCCTGGAAACTCTCTCAAGG + Intergenic
1129117733 15:73374689-73374711 GTTCCCTGGGGACTCTGCCAGGG + Intergenic
1132330999 15:101012630-101012652 GTGGCCTGGGCACTCTGCCTGGG - Intronic
1132636884 16:954194-954216 GTGCACTGGCCGCTCTGCCATGG + Intronic
1134059320 16:11189389-11189411 GTGACCTGTCCCCACTGCCATGG - Intergenic
1134066790 16:11233431-11233453 GTGACCTGGCAGCTGAGCCGAGG - Intergenic
1135498248 16:22971428-22971450 GTCAGCTGGCAGCTCTACCAGGG + Intergenic
1136146178 16:28317824-28317846 GTACCCTGGCCACTCTGCCCCGG - Intronic
1137268935 16:46890078-46890100 GTGATCTGGCAGCTCAGCCCTGG + Intronic
1140795968 16:78438501-78438523 TGGACCTGGGAACTCTGGCAAGG - Intronic
1141189839 16:81816440-81816462 GTGACCTGGCAAGTCTGAGAAGG + Intronic
1141978606 16:87535174-87535196 GTGACTTAGCAAATCTGCAAAGG - Intergenic
1142694433 17:1625831-1625853 GTTACCTGTCAAGTCTGCCCAGG + Intronic
1144087282 17:11822194-11822216 GTGTCCTGGCAACTGTGCTCAGG - Intronic
1144829430 17:18123109-18123131 GTGACCACGCACCTCAGCCAAGG - Intronic
1146367566 17:32240951-32240973 GGGACCTGGGAAGTCAGCCAAGG + Intronic
1146915416 17:36675374-36675396 GTGCCCTGGCAAATGTGCCCTGG - Intergenic
1147965878 17:44193939-44193961 CTGACCTGGGCACTGTGCCAGGG - Exonic
1148561790 17:48610600-48610622 GTGTCCCGGCGACTCCGCCAAGG - Exonic
1158552228 18:58446014-58446036 GTGACCTGTCTTCTCTGCCTCGG + Intergenic
1160514603 18:79471517-79471539 GTTACCTGGAAACGCTCCCAGGG + Intronic
1161543878 19:4868033-4868055 GTCACCCTGCAACTCTCCCAGGG - Intergenic
1164689852 19:30202484-30202506 GTCACCTGGCTGCTCTGGCAAGG + Intergenic
1165419698 19:35716818-35716840 CTGACCTGGCACCGCTGCTACGG + Exonic
1165708028 19:37990166-37990188 ATGACCTGGGAATTCTTCCAGGG - Intronic
1166351825 19:42202515-42202537 GTGACCTGTCCACTCTGACATGG - Intronic
1166512356 19:43417623-43417645 GTCACCTGGCATCTCTGCCTAGG - Intronic
1166648782 19:44554034-44554056 GAGACCTGGAAACTGTGTCAAGG + Intergenic
925685191 2:6463987-6464009 GTGACTGGGCACCTCTGCCAAGG - Intergenic
928172612 2:29013001-29013023 GTGACCTGGGAGCTCTGCACGGG + Intronic
928780828 2:34818375-34818397 GTGGCCTGGAAGCTGTGCCATGG + Intergenic
930048209 2:47192555-47192577 AAGACCTGGCAACTCTGACATGG - Intergenic
930798248 2:55415508-55415530 GTGGCCTGGAAACTCTTTCAAGG - Intronic
933709848 2:85316851-85316873 TTGAGCTGACAACACTGCCAGGG - Intergenic
933713212 2:85342873-85342895 TTGAGCTGACAACACTGCCAGGG + Exonic
936231346 2:110702154-110702176 GTGGCCTTTCATCTCTGCCAGGG + Intergenic
937851945 2:126643674-126643696 GTGAGCTGGCAGCACTGCCATGG + Intergenic
941821471 2:169848071-169848093 GTGGCCTGGAAACTCTGTCAAGG + Intronic
943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG + Intergenic
945648618 2:212533385-212533407 GTGACTTGGCTTCTCTGCCTGGG - Intronic
948284978 2:236777098-236777120 TTGTCCTGGCAACGCTGCCCAGG - Intergenic
948840865 2:240648258-240648280 GTGACCTGTGAACTCTGCTCAGG + Intergenic
1170701883 20:18711391-18711413 GTGACCTGTGAACTCTCCCTAGG + Intronic
1170882735 20:20311498-20311520 GTGGCCTGGGAACTCTCTCAAGG - Intronic
1174318428 20:49721048-49721070 GTCATCTGGAACCTCTGCCAGGG - Intergenic
1174895978 20:54450333-54450355 GTGACATGGAAACTCTAACATGG + Intergenic
1177208300 21:18036536-18036558 GTGGCCTGGAAACTCTGCCTAGG + Intronic
1180003925 21:45011077-45011099 GTGACCTGGAAACTCTCTCCGGG + Intergenic
1180478033 22:15729572-15729594 GCAACCAGTCAACTCTGCCACGG - Intergenic
1181108042 22:20586173-20586195 GGAACCTGGCAGCCCTGCCAAGG - Intronic
1183877686 22:40797937-40797959 CTGACCTGGAACCTCTGCAAGGG + Intronic
1184680363 22:46069804-46069826 GCAGCCGGGCAACTCTGCCAGGG - Intronic
951888969 3:27551553-27551575 GAGATCTGGCCACTGTGCCAAGG - Intergenic
951958078 3:28279899-28279921 GTGACCTAGCAACTCTTTCCAGG + Intronic
952345840 3:32484476-32484498 GTGACTAGGCAACTCAGCCTAGG + Intronic
953698207 3:45176367-45176389 GTTACCTGGAAGCTCTGCCAGGG + Intergenic
954436339 3:50498345-50498367 CAGACCTGGCAAAACTGCCAAGG + Intronic
956126977 3:66019865-66019887 TTGACCTGGCATCTATTCCATGG + Intronic
961529957 3:127534313-127534335 GTGACCTGGTCACTCTGGAAGGG - Intergenic
963272772 3:143302067-143302089 CTTACCTGGCACCTCTGCTAGGG + Intronic
967415656 3:189215311-189215333 GTGACCTTTCAAGTCTTCCATGG - Exonic
968928646 4:3563641-3563663 GTGACATTGCAGCTCTGCCGTGG + Intergenic
969363970 4:6683147-6683169 GTGGCCTGGGAGCTCTGCAAAGG - Intergenic
976744159 4:88386987-88387009 GTGTCATTGCAACTGTGCCATGG + Intronic
980098463 4:128517828-128517850 GAGACCTGGCAGCTCTGCCTGGG + Intergenic
983952358 4:173657146-173657168 GTGAGCTCTCAACTCTGTCACGG + Intergenic
984840708 4:184065002-184065024 GCAACCTGGCACCTCTTCCAGGG - Intergenic
990342796 5:54840427-54840449 GTGACCCAGCCACTCTGCAAGGG - Intergenic
990950627 5:61294808-61294830 TTTATCTGGCAACGCTGCCAGGG + Intergenic
994747173 5:103692786-103692808 CTGACCTGGGAACTCTGCTCTGG + Intergenic
998166456 5:139847225-139847247 GGGAGGTGGCAGCTCTGCCAGGG - Intronic
1000117455 5:158166870-158166892 GTGACCTTGGAACTCTTACAGGG - Intergenic
1002409229 5:179060905-179060927 ATGACCTCGCCACTCTGCCTCGG - Intronic
1003421491 6:5962075-5962097 GTGACAAGGCAACCCTCCCAAGG - Intergenic
1006620323 6:35359449-35359471 GTGCCATGCCAACACTGCCATGG - Intronic
1010980759 6:82365791-82365813 TAGACCTTGCAACTCAGCCAGGG - Exonic
1012620877 6:101341920-101341942 GTGACCTGGAAACTTTGTCTTGG + Intergenic
1017713329 6:157189696-157189718 GTCACCTGGAACCTCTGCCATGG - Exonic
1018762429 6:166903840-166903862 GTGCCCTGGCACCTCTGACCTGG + Intronic
1022627818 7:32056163-32056185 GGGACCTGGCAAATTTGGCAGGG + Intronic
1022754895 7:33276991-33277013 ATCACCTGCCAAGTCTGCCATGG - Intronic
1023271218 7:38464878-38464900 GTGACCTGTCTACCTTGCCAGGG - Intronic
1023898457 7:44454556-44454578 GTGACCTGGCAACTGTGAACTGG + Intronic
1024131282 7:46355059-46355081 GTGACCACGCAAATCTGCTAGGG - Intergenic
1026255060 7:68703987-68704009 GTAACTGGGCATCTCTGCCATGG - Intergenic
1028688008 7:93614321-93614343 GTCACCTGGAAACTCAGCTAGGG - Intronic
1029226777 7:99034202-99034224 GGGCCCTGGCCACTCTGCCCGGG + Intronic
1032496534 7:132367301-132367323 GTGGCCTAGCAGCTCTGTCATGG + Intronic
1032708321 7:134441367-134441389 GTGACCTGCCTACTCTGGCAGGG + Intergenic
1033444113 7:141405281-141405303 GCCACCTGGCATCTATGCCAAGG + Intronic
1034532143 7:151702476-151702498 GGGACCTGGCAAGACTGCCGTGG - Intronic
1036570244 8:9974071-9974093 GTGCCCAGGCCACTCTGCCCAGG - Intergenic
1037934214 8:22903787-22903809 GTGCCCTTGCAACTGGGCCAGGG + Intronic
1047393858 8:124475650-124475672 GTGACCTTGGACTTCTGCCAAGG + Intronic
1049327023 8:142027237-142027259 AGGACCTGGAAACTCTGTCAAGG - Intergenic
1049654055 8:143789985-143790007 GTGACCTGGCACTTCAGCCCAGG - Intergenic
1056036662 9:82613646-82613668 TTGACCTGAGAGCTCTGCCATGG - Intergenic
1058740035 9:107933813-107933835 ATTGCCTGGCAACTCTGCCAAGG + Intergenic
1187923655 X:24230394-24230416 GTGACCTGGAAACTCTTTCAAGG + Intergenic
1189502318 X:41574285-41574307 GTGGCCTGGAAACTCTCTCAAGG + Intronic
1189605787 X:42676394-42676416 CTGACCTGGCAACTCCCGCAAGG - Intergenic
1190385770 X:49880938-49880960 GTCACCTGTCAAGCCTGCCATGG + Exonic
1192173683 X:68872997-68873019 GTGTGTTGGAAACTCTGCCAGGG + Intergenic
1196113649 X:111974234-111974256 ATGACCTGGAAACTCTCTCAAGG - Intronic
1198331799 X:135629227-135629249 GCGACCAGGCAACTCTGGTATGG + Intergenic
1198334457 X:135653114-135653136 GCGACCAGGCAACTCTGGTATGG - Intergenic
1199461837 X:148093804-148093826 GTGGCCAGGCAACGCTGCCCTGG + Intergenic
1199878710 X:151955633-151955655 ATGACAAGGCAACTCTGCCCTGG + Intronic
1200122256 X:153796695-153796717 GTGACCTGTCAACACTGGCTAGG - Intronic
1202418234 Y:24644982-24645004 GTGATCTGACAATTCTGCAAGGG + Intergenic
1202452552 Y:25025104-25025126 GTGATCTGACAATTCTGCAAGGG - Intergenic