ID: 1080418586

View in Genome Browser
Species Human (GRCh38)
Location 11:32091424-32091446
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 2, 1: 1, 2: 1, 3: 16, 4: 200}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080418586_1080418606 29 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418606 11:32091476-32091498 GGGGGCGGCGCAGGTGTCCGAGG 0: 1
1: 0
2: 1
3: 35
4: 323
1080418586_1080418599 11 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418599 11:32091458-32091480 CGCGGCCAGGGCCCCGTGGGGGG 0: 1
1: 1
2: 1
3: 13
4: 238
1080418586_1080418596 9 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418596 11:32091456-32091478 GCCGCGGCCAGGGCCCCGTGGGG 0: 1
1: 0
2: 2
3: 24
4: 257
1080418586_1080418595 8 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418595 11:32091455-32091477 GGCCGCGGCCAGGGCCCCGTGGG 0: 1
1: 0
2: 3
3: 21
4: 274
1080418586_1080418592 -2 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418592 11:32091445-32091467 GCTAGGGTGAGGCCGCGGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 183
1080418586_1080418593 -1 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418593 11:32091446-32091468 CTAGGGTGAGGCCGCGGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 134
1080418586_1080418598 10 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418598 11:32091457-32091479 CCGCGGCCAGGGCCCCGTGGGGG 0: 1
1: 0
2: 2
3: 20
4: 240
1080418586_1080418594 7 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418594 11:32091454-32091476 AGGCCGCGGCCAGGGCCCCGTGG 0: 1
1: 0
2: 4
3: 46
4: 368
1080418586_1080418607 30 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418607 11:32091477-32091499 GGGGCGGCGCAGGTGTCCGAGGG 0: 1
1: 0
2: 0
3: 13
4: 116
1080418586_1080418602 20 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418602 11:32091467-32091489 GGCCCCGTGGGGGGCGGCGCAGG 0: 1
1: 0
2: 1
3: 41
4: 507
1080418586_1080418600 14 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418600 11:32091461-32091483 GGCCAGGGCCCCGTGGGGGGCGG 0: 1
1: 0
2: 5
3: 68
4: 694
1080418586_1080418591 -7 Left 1080418586 11:32091424-32091446 CCCGGACGAGAGCAAGGAGAGGC 0: 2
1: 1
2: 1
3: 16
4: 200
Right 1080418591 11:32091440-32091462 GAGAGGCTAGGGTGAGGCCGCGG 0: 1
1: 0
2: 2
3: 78
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080418586 Original CRISPR GCCTCTCCTTGCTCTCGTCC GGG (reversed) Exonic
901748516 1:11390719-11390741 TCCTCTCCTGGCTCTCGACAGGG - Intergenic
903354974 1:22740977-22740999 GCCTCTCCTTGCTGACGGCGGGG + Intronic
903545336 1:24120424-24120446 GCCTCTCCTTGCCCCATTCCTGG - Exonic
904263913 1:29306900-29306922 GCCTCTCCTTGGTCTTGCCAAGG + Intronic
904989538 1:34580555-34580577 GTCTCTTCTTGCTCTTGCCCAGG - Intergenic
907029701 1:51158306-51158328 GGATCTCCTTGCCCTCCTCCAGG + Intergenic
909251663 1:73364981-73365003 TCCTCTTCTTTCTCTCTTCCTGG - Intergenic
914808496 1:151008953-151008975 GCCTCTGCTTGCTGTCATCTTGG + Intronic
914984094 1:152441692-152441714 GCCTGTCCTGGCTCTTGTGCAGG - Intergenic
915310059 1:155002164-155002186 GTCTCGCCTTGCGTTCGTCCAGG - Intergenic
915528360 1:156489712-156489734 GCCTCTCCCTGCCCTTGCCCTGG - Intronic
918356496 1:183710078-183710100 GCCACAACTTGCTCTCCTCCAGG + Intronic
919866415 1:201786444-201786466 GCCTCTCCTTGGTCTCCTCCTGG - Exonic
920540171 1:206772233-206772255 TCCTGTCCTTTCTCTCTTCCTGG - Intronic
922721627 1:227902868-227902890 GCCCCTCCTTGCTCACGATCAGG - Intergenic
924093382 1:240525335-240525357 GGCTCTCCTGGCTCTCAGCCTGG + Intronic
924624806 1:245688998-245689020 GCCTCTCCTTTCCCACGGCCCGG + Intronic
1065239982 10:23695187-23695209 GCCTCTCCTCGCTCTCCCACTGG - Intronic
1067044738 10:42979099-42979121 TCCTCTCCTTCCTCTCTTCCAGG - Intergenic
1067348659 10:45456303-45456325 GCCTCTCCTTTCTGTCTCCCAGG - Exonic
1069882729 10:71603643-71603665 TCCTCACCTTGCTCACCTCCTGG + Intronic
1071011201 10:80942588-80942610 GACTCCCCTTGCTCCCTTCCTGG + Intergenic
1072335674 10:94395842-94395864 GCCTCTCTGTGCTCTTGGCCAGG - Intergenic
1072491208 10:95907688-95907710 GTCTCTCATCCCTCTCGTCCTGG - Intronic
1076218415 10:128714071-128714093 GACTCTCCTTTCTCTCTCCCTGG - Intergenic
1076514435 10:131035862-131035884 GACACTCCTTGGTCTCATCCAGG + Intergenic
1076924613 10:133476055-133476077 GCCTCTCCTTGCCCTGGGCTGGG + Intergenic
1077101993 11:826418-826440 GCCCCTCCTGGCTCTCCTTCTGG - Intronic
1077179071 11:1204167-1204189 GCCTCTTCCCGCTCACGTCCAGG - Intergenic
1077480420 11:2812003-2812025 GCCTCTCGTTCCTGTCCTCCTGG + Intronic
1078058796 11:8030615-8030637 GCCTGTCCATGCTTTTGTCCTGG + Intronic
1080418586 11:32091424-32091446 GCCTCTCCTTGCTCTCGTCCGGG - Exonic
1083159797 11:60848023-60848045 GCCTCTCCTTCTCCTCCTCCAGG - Exonic
1083475476 11:62912496-62912518 CCCTCTCCTGGCTCTGTTCCTGG + Intronic
1083840056 11:65299226-65299248 GCCTCTCCCTGATCTGGTCATGG + Intronic
1083932990 11:65856080-65856102 GGATCTCCTTGCCCTCCTCCAGG + Exonic
1084271093 11:68029637-68029659 GCCTGCCCTTGTCCTCGTCCTGG + Intergenic
1084537287 11:69764601-69764623 GCCTGTCCTTTCTTCCGTCCAGG - Intergenic
1084707942 11:70826547-70826569 GCCTGTCCTTCCTCCCATCCAGG - Intronic
1084957414 11:72698659-72698681 GCCTCTGCTTGCTCGCCTCCAGG + Intronic
1085316957 11:75551059-75551081 TCCTCTCCTTGCCTTCTTCCAGG + Intergenic
1088830466 11:113532221-113532243 GGCTCTGCTTGTTCTCCTCCAGG - Intergenic
1088909908 11:114183073-114183095 GCCTGTCTTTGCTCTCACCCTGG + Intronic
1089280118 11:117368372-117368394 GCCTCTCATGGCTCACCTCCAGG - Intronic
1089392843 11:118113812-118113834 GCCCCTGTTTGCTCTCCTCCAGG + Intronic
1089782089 11:120880664-120880686 GCCTCTCCTTGAGCATGTCCTGG + Intronic
1090253661 11:125268155-125268177 GCCCCTCCCTGCTCTCATCTCGG + Intronic
1091141910 11:133242566-133242588 GCCTCTCCTTGCCCTCATAAGGG + Intronic
1092847405 12:12596584-12596606 GCCTCTCCTCTCTCTCCTCTAGG + Intergenic
1095236696 12:39805119-39805141 GCCTGCCCTTGCTGTCTTCCTGG - Intronic
1095335890 12:41025827-41025849 GCCTATCCCTGCTCACGTTCTGG + Intronic
1096584894 12:52613681-52613703 GCCTCACCTTGGTCTGGTACAGG + Exonic
1097058731 12:56266962-56266984 CTCTCGCCTTGCTCCCGTCCAGG - Exonic
1097241186 12:57576331-57576353 GCTTCTCGTTGATCTCGTCCCGG - Exonic
1100685539 12:96983161-96983183 GCCTCTCGTTCCCCTCCTCCAGG - Intergenic
1103036638 12:117662284-117662306 GCCTCTCCTCCCTCTCTTCTGGG + Intronic
1103465741 12:121140638-121140660 GCCTCTCCTTGGTCTTCTTCAGG - Intronic
1104238797 12:126966616-126966638 GCCTCTCCATGCACCCTTCCTGG + Intergenic
1107942951 13:45391099-45391121 GCCTCTCCTTGCTCTCGTCCGGG + Intergenic
1108685501 13:52815592-52815614 GCCTCTCCTTCCACACCTCCCGG + Intergenic
1109721330 13:66280068-66280090 GCCACTTCTTGCACTCTTCCTGG - Intergenic
1111935196 13:94550229-94550251 GCCTCTCCGTGCTCCGGGCCCGG + Intergenic
1113914395 13:113862199-113862221 GCCCCTCCTCGCTGTCCTCCAGG - Intronic
1114559612 14:23580620-23580642 GCCTCTCCCTCCACACGTCCCGG - Intergenic
1119171465 14:72539215-72539237 GCCTCTCCTCGCTCCTGTTCTGG + Intronic
1121508951 14:94498094-94498116 ACCCCTGCTTGATCTCGTCCAGG + Exonic
1121521731 14:94590555-94590577 GCCTCCCCTTGCTCTGGACTTGG - Intronic
1121780260 14:96617680-96617702 GCCTCTCCCTGGGCTCATCCAGG - Intergenic
1122810618 14:104285956-104285978 GCCTCTCCTTGTCCTGCTCCTGG - Intergenic
1129609117 15:77038867-77038889 GCCTCTCCCAGCCCTCGCCCAGG - Intergenic
1130904941 15:88233695-88233717 TCCTCTCCTCCCTCTCCTCCTGG + Intronic
1131073482 15:89480300-89480322 GTCTCTCCTTGCTCTGCTCTAGG + Exonic
1131676573 15:94676145-94676167 CCCTCTCTTTGCTCTGGGCCTGG - Intergenic
1132523033 16:400191-400213 GCCTCACATTGCTCCTGTCCTGG + Intronic
1133062410 16:3183391-3183413 GCCTCTGCTTCCCCACGTCCTGG - Intergenic
1134830516 16:17319085-17319107 GCCTCTCCTTATTCTCTTGCTGG + Intronic
1135606083 16:23826039-23826061 TTCTCTCCTTACTCTAGTCCTGG + Intergenic
1136109124 16:28053586-28053608 GCCTCGCCTTGCTCTTTTCCAGG - Intronic
1136272666 16:29157913-29157935 GCCTCTCCTGGTTCTCCTCTGGG + Intergenic
1136281196 16:29212395-29212417 TCCCCTCCTTCCTCTCCTCCTGG - Intergenic
1142085560 16:88178318-88178340 TCCCCTCCTTCCTCTCCTCCCGG - Intergenic
1142627975 17:1204057-1204079 GCCTCTCCCTCATCTCGGCCTGG + Intronic
1142994284 17:3751614-3751636 CCCTCTCCTTCCTCTCCTCTGGG - Intronic
1146219775 17:31008453-31008475 GCCTTTCCCTCCTCTCGTCTGGG - Intergenic
1146737043 17:35247376-35247398 GCCTCTGCTTGTTCTCATCCAGG + Intronic
1146835703 17:36108812-36108834 GCCTCTGCTTGCTCGGCTCCTGG - Intergenic
1146850334 17:36216081-36216103 GCCTCTGCTTGCTCGGCTCCTGG - Intronic
1147359732 17:39923194-39923216 GCCTCGCCTTGCCCTGGTCCGGG + Exonic
1148081254 17:44968531-44968553 TCCTCTCCCTGCTCCCGCCCGGG - Intergenic
1148825927 17:50394212-50394234 GCCACTCCTTGCTGTACTCCAGG - Intronic
1149553749 17:57558662-57558684 GCCTCTCTTTGCTCTTGGCAGGG - Intronic
1150373594 17:64662177-64662199 GCCTTTCCCTCCTCTCGTCTCGG + Intergenic
1151335323 17:73436242-73436264 TCCTCTCCTCGCTCTCAGCCTGG + Intronic
1151713270 17:75818568-75818590 CCCTCTCCAGCCTCTCGTCCTGG + Intronic
1152151570 17:78604419-78604441 GCCTCTGCTTGTTCTCATCTGGG + Intergenic
1154355894 18:13623011-13623033 GCAGCTCCTTGCTCTGTTCCTGG + Intronic
1157754133 18:50203369-50203391 GCCTCTGCTTGCATTCTTCCAGG - Intergenic
1157993212 18:52522355-52522377 GCCTCCTCTTGTTCTCTTCCAGG + Intronic
1158652299 18:59299041-59299063 GCCTCTCCCTGCTCTTGGCCAGG + Intronic
1160720995 19:596836-596858 CCCTCTCCTGCCTCTCGCCCTGG - Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161495523 19:4584072-4584094 GCCTCTCCCTCCTCCCGCCCAGG + Intergenic
1162511839 19:11123685-11123707 CCCTCTCCTTGCCTTAGTCCTGG - Intronic
1164581928 19:29439998-29440020 GCCTCTCCCTCCTCACCTCCCGG - Intergenic
1167419802 19:49396107-49396129 ACCTCTCCTCACTCTAGTCCAGG + Intronic
1167821141 19:51928501-51928523 ATCTCTCCTTTCTCTCATCCTGG + Intronic
927151480 2:20198795-20198817 GCCTCACCTTGCTCTCCTACAGG - Intergenic
928113047 2:28525785-28525807 GCCTAGCCTTGCTCTGGTTCTGG - Intronic
929454117 2:42054412-42054434 GCCTTCCCTTGCTCTGGTCAAGG - Intronic
929673962 2:43905384-43905406 GCCTGTACTTTCTCTCGTTCTGG + Intronic
932340199 2:70958747-70958769 CCCTCTCCTCTCTCTAGTCCTGG + Intronic
932813317 2:74842517-74842539 GCCTCTTTTTGCTCCTGTCCAGG - Intronic
933041168 2:77468731-77468753 CTCTCTCCCTGCTCTCCTCCTGG + Intronic
934573211 2:95384840-95384862 GCCTCTCCTTGCCCCAGTCCTGG + Exonic
934736137 2:96690796-96690818 GCCACGCCTTGCTCTGGGCCAGG - Intergenic
935787716 2:106563901-106563923 GCCTCTCCTTCCTCTTCTTCGGG - Intergenic
936922056 2:117698900-117698922 TCCTCTCCTTTCTCTCTTACAGG + Intergenic
937829643 2:126405519-126405541 GCCTCTCTTTGCTTAGGTCCTGG + Intergenic
944482762 2:200174769-200174791 GCCTCTCCCTCCACACGTCCCGG - Intergenic
947451478 2:230212779-230212801 GCCTCTCCCTGCACTCATCCAGG - Exonic
947848642 2:233266001-233266023 ACCTCTCCTTGTTCTCTTGCAGG - Intronic
1169207989 20:3750543-3750565 GCCTCCCCTTGCTTTGGTGCAGG - Intronic
1169216985 20:3799836-3799858 GCCTAGCCTTGCTGTTGTCCAGG + Intronic
1174059262 20:47821129-47821151 GCCTGTTCTTGTTCTCTTCCTGG + Intergenic
1176096929 20:63348624-63348646 GCACCTCCTGGCTCTTGTCCCGG - Intronic
1179726970 21:43346282-43346304 GCCTGTCCTTCCTGTCCTCCTGG + Intergenic
1180911758 22:19455653-19455675 GTCTGTCCTGGCTCTCCTCCAGG - Intronic
1181038687 22:20181892-20181914 GCATCTCCTGGCTCCCGGCCTGG - Intergenic
1183673978 22:39289742-39289764 GTTTCTCCTTGCTCTCATCAGGG + Intergenic
1184168668 22:42745582-42745604 GCCTCTCCTCGCTCAACTCCTGG - Intergenic
1184245280 22:43232700-43232722 GCCTCTGCTTGCACACCTCCAGG + Intronic
1184884405 22:47333504-47333526 GCCTCTCCTTCTTCTTCTCCAGG - Intergenic
950260378 3:11538960-11538982 CCTTCTCCATGCTCTCTTCCAGG - Intronic
950460892 3:13121737-13121759 GCGCCTCCTTGCTGTGGTCCTGG - Intergenic
950523018 3:13507589-13507611 GCCTGTCCCTGCTCTTATCCAGG - Intergenic
953413744 3:42703850-42703872 GCGTCTCCTTGCTGTTCTCCAGG - Intronic
953663747 3:44910372-44910394 GCCTCTCCTCCCTCTGGTTCTGG - Intronic
953789860 3:45939051-45939073 TCCTCCCCTTGCTCTGGTCATGG + Intronic
953881827 3:46694780-46694802 GCCCCACATTGCTCTCCTCCTGG + Intergenic
957931162 3:86880063-86880085 TCCTCTCCCTGCTCTCCACCAGG + Intergenic
962328306 3:134454442-134454464 TCCTCTCCTTCCCCACGTCCTGG + Intergenic
962422884 3:135243602-135243624 GCCCCTCCTGGCTCTCTCCCAGG - Intronic
964729852 3:159853170-159853192 GCCTTTCCTTGCTCTGGCACCGG - Intronic
968672371 4:1858409-1858431 GGCTTTCCTTGTTCTGGTCCAGG - Intergenic
969263325 4:6047182-6047204 GCCTCTCCTGGCTTGCGTCTTGG - Intronic
978427214 4:108595066-108595088 TTTTCTCCTTGCTCTCTTCCTGG - Intergenic
979104245 4:116664368-116664390 GCAGCTCCTTGCTCCCCTCCTGG + Intergenic
986063053 5:4209691-4209713 GCCTCTCCTAACTCTGTTCCTGG - Intergenic
987229547 5:15879345-15879367 GCCTCTGCTTGCCCTCCACCAGG + Intronic
988201815 5:28078027-28078049 GCCTCTCCCTCCTCACATCCGGG + Intergenic
988698075 5:33644212-33644234 GCCTCTCCTTTCTCTCCTTTTGG + Intronic
990430256 5:55727835-55727857 GCCAATCCTTGCTCTAGTCTGGG - Intronic
993647013 5:90474507-90474529 GCCTCTGCTTGCTGCCGACCTGG - Exonic
997443028 5:133921983-133922005 TCTTCTCCTGGCTCTCCTCCAGG + Intergenic
997699286 5:135885210-135885232 ACCTCCCATTGCTCTGGTCCAGG + Intronic
998215602 5:140236669-140236691 GCCTCTGCTTCCTCTCCTACAGG - Intronic
999247042 5:150160596-150160618 GCCTCTCCTTGCCCCCTTGCTGG + Intergenic
1001058917 5:168471635-168471657 GCCTCTCCTTGGTCTAATCATGG - Intronic
1003012583 6:2439623-2439645 GCTTCTCCGTGCCTTCGTCCTGG - Intergenic
1003931184 6:10926073-10926095 GCCTCTCCTGTCTCTGGCCCAGG - Intronic
1004146250 6:13069483-13069505 GCCTCTCCTTGGACCAGTCCTGG + Intronic
1007998168 6:46330620-46330642 CCCTCTCCTTGATCGCATCCTGG + Intronic
1010236522 6:73579525-73579547 GCCTCTCCTCCCTATTGTCCTGG - Intergenic
1011416171 6:87122428-87122450 GCCTCTCCTTGCTCTTGTCCGGG + Intergenic
1012626961 6:101416362-101416384 GCCTCTCCCTGCTTGCTTCCTGG + Intronic
1016272067 6:142301531-142301553 GCTTCTCCTTTCTCTCGCCGAGG + Intergenic
1017159322 6:151350454-151350476 CCCTCTCCTTGCTCTTTTCTTGG - Exonic
1017237927 6:152136725-152136747 GGCTCTCCTTGCTGTCAGCCTGG + Exonic
1018230065 6:161666784-161666806 GCCTCTCACTGCTTTCTTCCAGG - Intronic
1021584849 7:22197066-22197088 CGCTCTCCTGGCTCTCCTCCTGG - Intronic
1022552185 7:31251439-31251461 GCCTCTCCTGGCTCTGCTGCTGG - Intergenic
1023888733 7:44377953-44377975 GCCCCTCCTGGCTCTCAGCCTGG - Intergenic
1024675736 7:51636537-51636559 ACCTCCCCTTGCTCTCACCCAGG - Intergenic
1025235651 7:57232904-57232926 GCCTGTTCTTGTTCTCTTCCTGG - Intergenic
1026901292 7:74038846-74038868 GCCTCTCCTGGCTCCAGCCCTGG - Intronic
1029320244 7:99752434-99752456 GCTTCTCCTTGCTGTCAGCCTGG - Intergenic
1032069584 7:128795513-128795535 ACCTCTGCTTGCTCCTGTCCAGG - Intronic
1033742072 7:144283510-144283532 GTCCCTGCTTGCTCTCCTCCTGG - Intergenic
1033751830 7:144366104-144366126 GTCCCTGCTTGCTCTCCTCCTGG + Intronic
1034284486 7:149875517-149875539 AGCTCTTCTTGCTCTGGTCCTGG + Intronic
1036438215 8:8755886-8755908 GCTTCTCCTTGCTCCCTTTCTGG + Intergenic
1036658732 8:10693961-10693983 GCCTCACCTTGCTCCCACCCAGG + Intronic
1037476572 8:19263615-19263637 GCATGTCCTTGATCTCCTCCTGG + Intergenic
1037781804 8:21874581-21874603 GCCTCTCCTTGCGCATGTCATGG - Intergenic
1039016845 8:33159080-33159102 GCCGCTCCTTCCTTTCTTCCTGG + Intergenic
1040639597 8:49317945-49317967 GGCTCTCCTTCCTCTGCTCCTGG + Intergenic
1040806874 8:51405153-51405175 GCCTCTCCTTCCACACCTCCTGG + Intronic
1041588333 8:59547107-59547129 GCCTCTCCTTCCACCCCTCCCGG - Intergenic
1048437803 8:134433867-134433889 TCCTCTCCTTCCTCTCCTGCTGG - Intergenic
1048941373 8:139403450-139403472 GCCTCTGCTTGCTCTCCTCTGGG + Intergenic
1049028353 8:140013246-140013268 GCCTCTCCGTGCACTCCTCCAGG + Intronic
1049615000 8:143572222-143572244 ACCTCTCCTAGCTCTCCTCCTGG + Intronic
1049659568 8:143813726-143813748 GCCTCTGCTTCCTCCCATCCAGG - Exonic
1051136262 9:13925310-13925332 GACTCTCCTTGGTATCTTCCTGG - Intergenic
1051857825 9:21589508-21589530 CCCTCTCCTTGGTCTCCTCCTGG + Intergenic
1053353693 9:37429715-37429737 GACTCTCCTTGCTCTAGGCCAGG + Exonic
1053357307 9:37457042-37457064 GCCACTCCTTGCTCTCATTCTGG - Intronic
1053569473 9:39288746-39288768 GCCTCTCCCTGCTCCTGGCCCGG - Intergenic
1053835434 9:42129767-42129789 GCCTCTCCCTGCTCCTGGCCCGG - Intergenic
1054091104 9:60847730-60847752 GCCTCTCCCTGCTCCTGGCCCGG - Intergenic
1054112515 9:61123286-61123308 GCCTCTCCCTGCTCCTGGCCCGG - Intergenic
1054127673 9:61330264-61330286 GCCTCTCCCTGCTCCTGGCCCGG + Intergenic
1054595191 9:67058843-67058865 GCCTCTCCCTGCTCCTGGCCCGG + Intergenic
1055971290 9:81915363-81915385 TCCTTTCTTTGTTCTCGTCCTGG + Intergenic
1056252311 9:84762248-84762270 GCCTCTCTTTGCTCTCAAGCTGG - Intronic
1056376629 9:86020193-86020215 GTCTCTCCTATCTCTCTTCCAGG - Intronic
1056752837 9:89364359-89364381 GCCTCTCCATGCTGTGGCCCTGG - Intronic
1059485642 9:114624604-114624626 CCCTCTCTTTCCTCTCTTCCCGG + Intronic
1061534436 9:131238917-131238939 ACCTCTCCTTGCTGGCATCCTGG + Intergenic
1061838912 9:133346623-133346645 GCGTCTCCTTGCTCTGGGGCAGG + Exonic
1061847427 9:133395486-133395508 GGCTCTCCCTGGTCTCCTCCTGG + Intronic
1062539587 9:137035676-137035698 GTCTGTCCTTGTTCTCCTCCAGG + Exonic
1186901815 X:14065545-14065567 GCCACTTCATCCTCTCGTCCAGG - Intergenic
1195349808 X:103985433-103985455 TCCCCTCCTAGCTCTCTTCCAGG + Intergenic
1195352124 X:104005709-104005731 TCCCCTCCTAGCTCTCTTCCAGG - Intergenic
1195357635 X:104053406-104053428 TCCCCTCCTAGCTCTCTTCCAGG - Intergenic
1195616377 X:106915824-106915846 GTCTCTCCTTCCTCTTCTCCTGG + Intronic
1198312477 X:135435830-135435852 GCTGCTTCTTGCTCTCGGCCAGG - Intergenic
1199329685 X:146544104-146544126 CCCTCACCTTGCTCTCATTCTGG - Intergenic
1199511379 X:148626746-148626768 CCCTCTCCTTTCTCTCGTAAGGG + Intronic