ID: 1080419796

View in Genome Browser
Species Human (GRCh38)
Location 11:32099669-32099691
Sequence GGATTGAAACAGTTGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080419796_1080419803 19 Left 1080419796 11:32099669-32099691 CCCAGTTCCAACTGTTTCAATCC 0: 1
1: 0
2: 0
3: 3
4: 150
Right 1080419803 11:32099711-32099733 GCTTTTGTTTACACGAGCTGTGG 0: 1
1: 0
2: 2
3: 4
4: 57
1080419796_1080419804 23 Left 1080419796 11:32099669-32099691 CCCAGTTCCAACTGTTTCAATCC 0: 1
1: 0
2: 0
3: 3
4: 150
Right 1080419804 11:32099715-32099737 TTGTTTACACGAGCTGTGGATGG 0: 1
1: 0
2: 0
3: 1
4: 81
1080419796_1080419801 -9 Left 1080419796 11:32099669-32099691 CCCAGTTCCAACTGTTTCAATCC 0: 1
1: 0
2: 0
3: 3
4: 150
Right 1080419801 11:32099683-32099705 TTTCAATCCTGGGAAACAGATGG 0: 1
1: 0
2: 1
3: 44
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080419796 Original CRISPR GGATTGAAACAGTTGGAACT GGG (reversed) Intronic
900005663 1:47956-47978 GGATTGAAATAATTGGAGATAGG - Intergenic
906094177 1:43209426-43209448 GGATTGAATGAGTTGCAACATGG + Intronic
907678805 1:56544207-56544229 GGGCTGAAACAGCTGGAGCTGGG - Intronic
908178494 1:61579979-61580001 GGATTTTAACAGTTGGACCAGGG - Intergenic
908366133 1:63425513-63425535 GGGTTGAAGCTGTTGGAAGTAGG + Intronic
908868545 1:68580667-68580689 AGATGGAAACAGTAGGCACTGGG + Intergenic
908998200 1:70184686-70184708 TGATTGAAACTGTGGGAACATGG - Intronic
912267355 1:108172283-108172305 TGATTGAAACAGCTGTGACTGGG - Intronic
912776050 1:112507178-112507200 GGATGGTTACAGTTGCAACTAGG - Intronic
913149044 1:116022094-116022116 GGGTTGGACCAGTTAGAACTAGG + Intronic
913470602 1:119182101-119182123 GTATTGTAACAACTGGAACTGGG - Intergenic
920458653 1:206119461-206119483 GGATTGTAATAGCTGGAAGTGGG - Intergenic
924677890 1:246199143-246199165 GGATGGGAACAGTAGGTACTGGG - Intronic
1064782415 10:18856988-18857010 GGACTGAAACAGGTGGGAGTGGG + Intergenic
1065384540 10:25121480-25121502 AGATGGAAACAGTAGGCACTGGG + Intergenic
1065929575 10:30467761-30467783 GGATGGCAACAGCTGGCACTAGG + Intergenic
1069536578 10:69257964-69257986 GGATTGGAACAGGTGGAGATGGG + Intronic
1069785671 10:70986435-70986457 GGATTGATACAGTGGGAAGAGGG + Intergenic
1070762661 10:79034415-79034437 GGATTGAAAGAGCAGGAACAGGG - Intergenic
1073134363 10:101211912-101211934 GGATGGAAACAGATGGAAGGGGG + Intergenic
1074998961 10:118781367-118781389 GCATGGGAACACTTGGAACTGGG + Intergenic
1075337395 10:121618096-121618118 GGAGTGAAGGAGGTGGAACTTGG - Intergenic
1076414628 10:130277066-130277088 GGATTTAAACAGTGGGAAGATGG + Intergenic
1080419796 11:32099669-32099691 GGATTGAAACAGTTGGAACTGGG - Intronic
1080978684 11:37374526-37374548 GGATTGAAAAACTTGGGACAAGG + Intergenic
1084869343 11:72086427-72086449 GGACTGAAACAGCTGAACCTGGG + Intronic
1084934141 11:72578115-72578137 GGGATGAATCAGTTGGACCTGGG + Intronic
1087762753 11:102119620-102119642 GCATTTAAATAGTTGAAACTTGG + Intronic
1087942129 11:104110961-104110983 GAATTGAAACTGTTTGCACTAGG - Intronic
1088801144 11:113308392-113308414 GGATTTAGAGAGTTGGGACTTGG + Intergenic
1091936484 12:4439010-4439032 GGAATGAAACACTGGTAACTGGG + Intronic
1095543630 12:43340453-43340475 GGATTGAAACACATGGCAGTTGG - Intergenic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1098216629 12:68227388-68227410 GGAAAGAAACAGTGTGAACTTGG + Intergenic
1098351241 12:69563344-69563366 GGATAGACACAGCTGGAACATGG - Intronic
1100724865 12:97397632-97397654 GGATGGGAACAGTAGGCACTGGG + Intergenic
1104851787 12:131879479-131879501 GTATTTTAACAATTGGAACTGGG - Intergenic
1105449697 13:20488262-20488284 GGGTAGAAACAGGTGGCACTGGG + Intronic
1107002163 13:35560575-35560597 GGAGTGAAGAAGTTAGAACTGGG + Intronic
1107235005 13:38157624-38157646 GGATGGAAACAGTAGACACTGGG - Intergenic
1108210817 13:48138283-48138305 TGATGGAAATATTTGGAACTAGG - Intergenic
1109177714 13:59176611-59176633 GGATTGGAATATATGGAACTGGG - Intergenic
1109922792 13:69091040-69091062 GGACTGAAACAGATGGAATTAGG - Intergenic
1110345562 13:74443735-74443757 GGATTAATATAGTTGAAACTTGG + Intergenic
1110658269 13:78026525-78026547 GAAGAGAAACAGTAGGAACTAGG - Intergenic
1111763143 13:92491778-92491800 GAATTGACACAGTTTGAATTTGG - Intronic
1114888304 14:26883084-26883106 GAATTGCATCAGTTGGAGCTGGG + Intergenic
1115137558 14:30129128-30129150 AGCTTAAAACAGTTGGCACTAGG + Intronic
1121006612 14:90494744-90494766 GGAGTGACAGAGATGGAACTGGG - Intergenic
1121394200 14:93604530-93604552 GGATTTAAACAGTTTCACCTGGG - Intronic
1129792565 15:78351062-78351084 GCAATGAAGCAGTGGGAACTGGG - Intergenic
1132447852 15:101942966-101942988 GGATTGAAATAATTGGAGATAGG + Intergenic
1133937416 16:10280383-10280405 GGATTTAACCTGTTTGAACTGGG + Intergenic
1134225169 16:12384399-12384421 GGATTAAAACCATTTGAACTGGG + Intronic
1134589093 16:15437599-15437621 GGATTGAAACTGCTGTAAATTGG - Intronic
1135076931 16:19401907-19401929 GGACTGAAACAGGTGGAAGTGGG + Intergenic
1135875672 16:26197892-26197914 GGGTTGGAACAATTAGAACTTGG - Intergenic
1137611514 16:49821432-49821454 GCATGGAATCAGTTGGAAATGGG - Intronic
1143023166 17:3927061-3927083 GGATTGAACCTGGTGGAACAGGG - Intronic
1149253184 17:54793936-54793958 GGGTGGAAAAAGTTGGATCTAGG - Intergenic
1149840717 17:59962273-59962295 GGATTAAAAGAGTTAGAACACGG - Intronic
1153015895 18:582498-582520 GGATGGGAACAGGTGCAACTTGG + Intergenic
1154060235 18:11053622-11053644 GGATTGAAACAGATGCAATATGG - Intronic
1154507190 18:15053282-15053304 GGCTTGAAACAGGTGGTACAGGG + Intergenic
1157094092 18:44671152-44671174 GTATTGAATCACTTGGAGCTGGG + Intergenic
1157157995 18:45286461-45286483 GGATTCTAAAATTTGGAACTTGG - Intronic
1157841573 18:50964232-50964254 GGATAGAAGCAATTTGAACTGGG - Intergenic
1159974569 18:74694580-74694602 AAAATGAATCAGTTGGAACTTGG - Intronic
1160637422 19:89567-89589 GGATTGAAATAATTGGAGATAGG - Intergenic
1164539720 19:29113812-29113834 GAATTGAAAGAGTTGGCACAGGG - Intergenic
925232743 2:2249983-2250005 GGATAGAAGCCGTTGTAACTGGG - Intronic
929982467 2:46694435-46694457 GGACTGAAACAGTCAGATCTGGG + Intergenic
931219689 2:60277875-60277897 GGAATGAAGCAGTGGCAACTAGG - Intergenic
932642167 2:73460196-73460218 GGGTTGAAAGAGTTGGGGCTGGG - Intronic
933066761 2:77807826-77807848 GGACTGAAACAGATGGGAGTGGG - Intergenic
934197159 2:89848042-89848064 GAATTGAAACATTTGGAAACAGG + Intergenic
935188186 2:100753345-100753367 TGATAGACACACTTGGAACTGGG - Intergenic
935730546 2:106061701-106061723 GGATTTAAACAGATGAAATTTGG + Intergenic
936615513 2:114043812-114043834 GGATAGAATGAGTTGGAAATAGG + Intergenic
1176790693 21:13315825-13315847 GGCTTGAAACAGGTGGTACAGGG - Intergenic
1179536046 21:42053299-42053321 GGATTGAAATGGTTGGGTCTGGG + Intergenic
1181532944 22:23527483-23527505 GCCTTGAAAAAGCTGGAACTTGG - Intergenic
1181610760 22:24010047-24010069 GGAGAGAAACAGTTGAAAATAGG - Intergenic
1181948586 22:26538126-26538148 GGATGAAAACATTTAGAACTAGG - Intronic
1181953535 22:26571861-26571883 GGAGAGAAACAGTTGGATCCTGG - Intronic
1184509388 22:44924419-44924441 GGATTTCAACATTTGGATCTGGG - Intronic
1185153394 22:49179285-49179307 GGATGGAAACACTTGGACCGTGG - Intergenic
950356377 3:12413506-12413528 GGATTGAAAAAGCTGGAATGGGG + Intronic
951255427 3:20443958-20443980 TGATTAATACATTTGGAACTTGG + Intergenic
951595289 3:24312118-24312140 GAATTGAAATAGTGGGAAGTAGG - Intronic
952363789 3:32657068-32657090 GGAGTGAAACAGTGCGATCTCGG + Intergenic
956847586 3:73197436-73197458 GGTTTCAACCAGTTTGAACTGGG - Intergenic
960470193 3:118054892-118054914 GAATTGCAACATTAGGAACTTGG + Intergenic
961724179 3:128915206-128915228 GGATCGAGACAGGTGGAGCTGGG - Exonic
962657187 3:137559297-137559319 GAATTTAAACAATTGAAACTGGG + Intergenic
964966332 3:162497449-162497471 GTAATGAAACAGTTGTAGCTAGG + Intergenic
965364550 3:167782806-167782828 GGATTTGAACATATGGAACTTGG + Intronic
965631188 3:170734518-170734540 AGATGGAAACTGTTGGGACTCGG - Intronic
966075895 3:175936468-175936490 GGAGTGCCACAGTGGGAACTCGG - Intergenic
966422862 3:179751169-179751191 GGAGTGAATGAGCTGGAACTAGG + Intronic
972379401 4:38505132-38505154 GGATGGAAACATATGGAACCTGG - Intergenic
972891682 4:43564746-43564768 GGACTGAAACAGATGGAAGGGGG + Intergenic
974188236 4:58467571-58467593 GGATTGAAAGATGTGGAAATAGG - Intergenic
974520876 4:62978425-62978447 GGGTTCAAACAGCTGGTACTAGG + Intergenic
975912038 4:79278398-79278420 GGATTGAAGAGGTAGGAACTAGG - Intronic
978084468 4:104633450-104633472 AGGTTGAAACATTTGGATCTGGG + Intergenic
978158882 4:105522020-105522042 GGATTCAAAGAGAGGGAACTAGG - Intergenic
978801492 4:112759848-112759870 CTATGGAATCAGTTGGAACTTGG - Intergenic
979126559 4:116980446-116980468 GGACTGAAACAGGTGGGAGTGGG - Intergenic
983266842 4:165516187-165516209 GGATTGGATCAGTTGGCACATGG + Intergenic
983661393 4:170133639-170133661 GGACTGAAACAGGTGGGAGTGGG + Intergenic
984113425 4:175648196-175648218 GGGATGAAACCTTTGGAACTTGG + Intronic
985217845 4:187672261-187672283 GCGTTGTAACAGTTTGAACTGGG - Intergenic
988167304 5:27610409-27610431 ACATGGAATCAGTTGGAACTGGG - Intergenic
990171190 5:53051835-53051857 AGATTAAAACAGTAGGAAATGGG + Intronic
990171419 5:53054246-53054268 AGATTAAAACAGTAGGAAATGGG - Intronic
991024803 5:62018279-62018301 GGCTTGGACCCGTTGGAACTTGG - Intergenic
991525984 5:67558153-67558175 GTATGGAAAGAGTTGAAACTGGG + Intergenic
995590537 5:113695079-113695101 GGAGTGAAAATGCTGGAACTAGG + Intergenic
999524464 5:152388769-152388791 GGATAGAAACAGATGGAGATTGG + Intergenic
1000206392 5:159063842-159063864 GGATTGAAACACCTAGCACTGGG - Intronic
1006685861 6:35833241-35833263 GGATTGAAAGATGTGGAAATAGG - Exonic
1008502569 6:52198505-52198527 GGAGTGAAACAGTTTAAAGTTGG + Intergenic
1008799946 6:55354822-55354844 GAATTGAAAAATTTGGAACAGGG - Intronic
1009378120 6:62996571-62996593 GGATAGAGACATTGGGAACTTGG + Intergenic
1011644405 6:89443950-89443972 TGATAGAAAAAGTTGGCACTGGG + Intronic
1012788768 6:103664836-103664858 GGATGAAAACAGTTGGATTTTGG - Intergenic
1015268455 6:131313919-131313941 AGATGGCAACAGTAGGAACTGGG - Intergenic
1015917079 6:138228225-138228247 GGAGTGAAACAGTGTGATCTCGG + Intronic
1021446481 7:20739174-20739196 AGATGGCAACAGTAGGAACTGGG + Intronic
1021823028 7:24516846-24516868 GGGTTGAAAGAGTGGGAACGAGG + Intergenic
1024638169 7:51307854-51307876 GGATTTAAAAAGTGGGAATTGGG - Intronic
1026313482 7:69208534-69208556 GGATTGCAACAGTGTGATCTTGG + Intergenic
1028192216 7:87866731-87866753 GGACTGAAACAGGTGGGAGTGGG - Intronic
1031085176 7:117295584-117295606 GGATTGAAGCAGTTTGCACAGGG - Intronic
1031264370 7:119565650-119565672 GGATTGCAAGATTTTGAACTAGG + Intergenic
1032074228 7:128828850-128828872 GGCTTGAAAAAGGGGGAACTGGG + Intergenic
1032444300 7:131968373-131968395 GGATTGAAATAGTTCAAACGGGG + Intergenic
1034625153 7:152486950-152486972 GGATTAAATCAATTGCAACTGGG - Intergenic
1041829773 8:62141521-62141543 GGATTAAAACTATTAGAACTAGG - Intergenic
1044921255 8:97171909-97171931 GAACTGAAACAGTTGGATCCAGG + Intergenic
1048153971 8:131923882-131923904 TGAATGAAACAGTTTGAAATTGG + Intronic
1048220458 8:132536377-132536399 GGATTGAACCAGGAGAAACTGGG - Intergenic
1056850286 9:90078067-90078089 GGATTGACACAGATGGTATTTGG - Intergenic
1059027194 9:110647906-110647928 TGATGGAAAAGGTTGGAACTAGG + Intergenic
1060286831 9:122261103-122261125 GGATTCAAATAGTTGGAAATGGG + Intronic
1060400340 9:123344955-123344977 GGATTGAATGAGTTAGAATTTGG + Intergenic
1061744382 9:132728837-132728859 GGGATGAAACCATTGGAACTAGG - Intronic
1191060435 X:56290026-56290048 GGATGGATACAGAAGGAACTGGG + Intergenic
1191668733 X:63729591-63729613 GGATGGTAACAGTTGGATTTTGG - Intronic
1196174366 X:112624717-112624739 GGATTGGAAGATTTGGATCTTGG + Intergenic
1197480611 X:126980563-126980585 AGCAAGAAACAGTTGGAACTAGG + Intergenic
1198006498 X:132499882-132499904 GGACTGAAGCATTTGGACCTGGG - Intergenic
1198296321 X:135291315-135291337 GGCTTGGCACAGTGGGAACTGGG - Intronic