ID: 1080419939

View in Genome Browser
Species Human (GRCh38)
Location 11:32100818-32100840
Sequence GAAAAGGCTGGCCCTACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080419936_1080419939 -1 Left 1080419936 11:32100796-32100818 CCTCATTCAGTGGAGAAGAGATG 0: 1
1: 0
2: 0
3: 14
4: 203
Right 1080419939 11:32100818-32100840 GAAAAGGCTGGCCCTACACAAGG 0: 1
1: 0
2: 1
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080419939 Original CRISPR GAAAAGGCTGGCCCTACACA AGG Intronic
901816359 1:11795679-11795701 TAAAAGGCTGGCTCAACCCAAGG - Intronic
906101661 1:43267762-43267784 GGAAAGGCAGGCTCTTCACAGGG - Intronic
908854186 1:68406078-68406100 GAGCAGGCTGGCCATCCACATGG + Intergenic
910679968 1:89852916-89852938 GAAATGCATGGCCCTAGACATGG - Intronic
914936573 1:151986770-151986792 AAAAAGGCTGGCAATACATATGG - Intronic
915863846 1:159477106-159477128 CAAAAGGCCCACCCTACACAGGG + Intergenic
915889195 1:159755761-159755783 GGATAGGCTGTCCCCACACAGGG - Intergenic
916725324 1:167517775-167517797 GACAAGGCTGAGCCTAGACACGG + Intronic
921988447 1:221337646-221337668 GAAAAGGCTGACTCTAAATAAGG + Intergenic
922669151 1:227495462-227495484 CAAAAGGCTTCCCCTCCACACGG - Intergenic
922670446 1:227505840-227505862 CAAAAGGCTTCCCCTCCACACGG + Intergenic
1063145115 10:3289355-3289377 GAGAAGGCAGCCCCTGCACACGG + Intergenic
1065130277 10:22613256-22613278 GGAAATGCTGGCACTGCACAGGG + Intronic
1067522726 10:47020421-47020443 GGAAAGGCTGGGGTTACACAGGG + Intergenic
1069587145 10:69614920-69614942 GAAAAAGCTAGCTGTACACATGG - Intergenic
1069615460 10:69803489-69803511 GGAAAGGCTGGGCCTTGACAGGG + Intronic
1070949562 10:80420018-80420040 GAGAAAGCTGCCCCTACCCAGGG + Intronic
1076199152 10:128544563-128544585 AGAAAGGCTGGCTCTACACTTGG - Intergenic
1077556428 11:3228206-3228228 CATAAGGCTGGCCCCACACATGG + Exonic
1080419939 11:32100818-32100840 GAAAAGGCTGGCCCTACACAAGG + Intronic
1084169807 11:67395668-67395690 GAAATGCCTGGCCCTGCCCAGGG - Intronic
1084530550 11:69725274-69725296 GAAAAGGCAAGACCTACACACGG + Intergenic
1085061632 11:73452624-73452646 GAAAAGGTAAGCCCTAGACATGG - Intronic
1085200328 11:74697984-74698006 GAAAAGGCTTGGCCTCCTCAGGG - Intronic
1090006488 11:123007348-123007370 GGAAAGGCTGGCCCTGCACTTGG + Intergenic
1096880274 12:54662004-54662026 AAAAAGGATTTCCCTACACAGGG - Intergenic
1097919345 12:65055032-65055054 GAAAAGGCTGGCCCTTCTTCTGG + Intronic
1108248763 13:48544044-48544066 TAAATGGCTGGTCCTGCACAGGG + Intergenic
1110134232 13:72045485-72045507 GAAAAGGCTGGCAGCACAGAGGG + Intergenic
1113940641 13:114016961-114016983 GAAAAGCCTGGCTCTTCCCAGGG - Intronic
1117400180 14:55351978-55352000 GAAGAGGCTGGCAGTACAAATGG - Exonic
1118887828 14:69881022-69881044 GCAAGGGCTGGCCCAACACGGGG - Intronic
1122247937 14:100417422-100417444 AAAGAGCCTGGCCCCACACATGG - Intronic
1122623200 14:103071293-103071315 GAACAGGCTGGCCCCACCCTCGG - Intergenic
1122787991 14:104172757-104172779 AAGGAGGCTGGTCCTACACATGG + Intronic
1124047047 15:26160112-26160134 GAAAGGGCTAGCTCTTCACAGGG + Intergenic
1132151292 15:99461593-99461615 GAAATGGCTGGCACTACATCTGG + Intergenic
1133868223 16:9663836-9663858 GAACAGGCTGGCCTTAAACCTGG + Intergenic
1138032467 16:53570725-53570747 GAAGTAGGTGGCCCTACACAAGG + Intergenic
1141249863 16:82345532-82345554 GACAATGCTTGCCCTACTCAAGG - Intergenic
1141350952 16:83296156-83296178 GAAAATTATGGCCCTATACAAGG - Intronic
1142396047 16:89832165-89832187 GAAAAGGATGCCCCTTCACATGG - Intronic
1142697050 17:1639580-1639602 GGAAAGGCGGGCCCTTCACATGG - Intronic
1143490908 17:7284753-7284775 CAACAGGCTGGCCCTACCCTGGG - Intronic
1149525540 17:57352689-57352711 TAAAAGGCTGTACCTAGACAGGG + Intronic
1153675299 18:7451743-7451765 GAAAAGGCGGGGCCTGCCCATGG + Intergenic
1156078995 18:33312752-33312774 GGAATGGCTGTCGCTACACAGGG + Intronic
1157280188 18:46341918-46341940 CAAAAGGCCATCCCTACACATGG + Intronic
1160945849 19:1643729-1643751 GAACAGGCAGACCCTTCACAGGG + Intronic
1161315679 19:3616170-3616192 GAAAGGCCAGGCCCTACACAGGG + Intronic
1161772778 19:6240301-6240323 GAAGAGGCTGGCCCTGGTCAGGG + Intronic
1166079408 19:40434195-40434217 GGAAAGGCTGGCCCTGCAGAAGG - Intergenic
1167122473 19:47526668-47526690 AAAAGGACTGGCCCTACCCAGGG + Intronic
1167468063 19:49660662-49660684 GAAAGGGGTGGCCTTACAGAGGG - Intronic
1168343631 19:55640363-55640385 GGAAAGGCTGGCACTGCCCACGG - Intronic
926060169 2:9800232-9800254 GAGAAGCGTGGCCCTACAGAGGG - Intergenic
926312676 2:11685988-11686010 GAGAAGGCTGCACTTACACAAGG - Intronic
928413292 2:31070824-31070846 AGAGAGGCTGGCCCTACCCAGGG + Intronic
932775756 2:74527443-74527465 GGAAAGGGTGGCCCCACACTGGG - Intronic
937261806 2:120591390-120591412 GAAGAGGCTGGGCCTAGAGAGGG - Intergenic
939817427 2:146912923-146912945 GAAAAGGCTGGAGCTAGAAAAGG + Intergenic
940912919 2:159224840-159224862 GAAAGGGCTTTCCCTACTCAGGG - Intronic
946925153 2:224619092-224619114 GAAAAGGCTGACCCTCCCCCAGG - Intergenic
1170690508 20:18611129-18611151 GAAAAGGTTAGCCCTTGACAAGG - Intronic
1170737399 20:19023729-19023751 GACCAGGCAGGCCCTACAAAAGG - Intergenic
1171396639 20:24838720-24838742 AAGAAGGCTGGCCCTGCACAAGG + Intergenic
1172229431 20:33326996-33327018 CAAAAGGCTGTCCCTCCACTGGG + Intergenic
1178517906 21:33264281-33264303 GAGAAGGGGGGCCCTGCACAAGG + Exonic
1179178124 21:39023246-39023268 GAAAAGGCAGGCCCCTCCCAAGG + Intergenic
1179267688 21:39819227-39819249 GAAAAGACTGGACGTACACGGGG - Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184959805 22:47920779-47920801 GTCAAGGCTGGCCCTACATCAGG - Intergenic
949165655 3:938074-938096 GTAAAGGCTGGCCCTTCAGCTGG + Intergenic
949724053 3:7023455-7023477 GAAAATGATGCCCCAACACAAGG - Intronic
950735870 3:15007541-15007563 GAAGAGACTGGCAATACACAAGG - Intronic
952952020 3:38533058-38533080 GAACAGACTGGCCCTCCTCAGGG + Intronic
954756528 3:52843430-52843452 CTAGAGGCTGGCGCTACACATGG + Intronic
955125415 3:56106185-56106207 GAACAGGCAGGCCCTTCTCAAGG - Intronic
956754096 3:72368392-72368414 GAAAAGGCTGGCCCTCCCCAGGG - Intergenic
957434620 3:80158800-80158822 GAAAAGCCTGTTCCTACATAGGG + Intergenic
961677030 3:128573944-128573966 GGAAAGACAGGCCCTTCACAGGG + Exonic
962074369 3:132065456-132065478 GAAAAAACTGGCCCAACATAAGG + Intronic
962978699 3:140468684-140468706 GAAAGGGCAGGTCCTACCCACGG - Intronic
963426894 3:145141097-145141119 AAAAAGACTGGCCCTACCAAGGG - Intergenic
965513262 3:169592553-169592575 GTAAAGGCTGGACCTAAACTGGG - Intronic
966632237 3:182090303-182090325 GAAAAGACTTGCCCTACCAAAGG + Intergenic
967573450 3:191060423-191060445 GATAATGCTGGCCTCACACAAGG - Intergenic
968005587 3:195240540-195240562 GCAAGGGCTGGCCCCACGCACGG + Intronic
972203031 4:36738151-36738173 GAAAAGGCTAGGGCTACACGAGG - Intergenic
973218698 4:47700726-47700748 GAAGAGGCTGGACCTCCAAAAGG - Intronic
975952015 4:79785369-79785391 GATAAAGCAGGCCCTCCACACGG + Intergenic
977910846 4:102534309-102534331 GAAAAGGCTGGGGCTACCAAAGG - Intronic
985826417 5:2195043-2195065 GACAGGGATGGTCCTACACATGG - Intergenic
987294645 5:16539138-16539160 GAACACTCTGGCCCTTCACAGGG - Intronic
992842301 5:80708077-80708099 TAAAAGGCAGGCCATACACTGGG - Intronic
996123325 5:119695638-119695660 GAAAATGGTGGCCCTTTACAAGG + Intergenic
999140106 5:149355369-149355391 GGGAAGGCTGGCCCAACAGAGGG - Intergenic
1006826306 6:36938790-36938812 GCAAGGGCTGGCCCTGCACTGGG + Intergenic
1007730564 6:43942914-43942936 GAAAGAGCTGGGCCTACTCAGGG + Intergenic
1013582702 6:111551894-111551916 GAAAAGGCTGGCGCTAGACTTGG - Intergenic
1014098378 6:117483271-117483293 GAAAGAACTGGCCCTGCACACGG - Intronic
1014126778 6:117785313-117785335 GAAAAGGCAGGCCACACACTTGG - Intergenic
1019311039 7:360781-360803 AAAAAGCCTGGCCCTACCCAGGG - Intergenic
1019629941 7:2043694-2043716 AAAAAGGCTGGCACTCCGCAGGG - Intronic
1021423551 7:20472763-20472785 GTACAGGCTTGCCCTACATAAGG + Intergenic
1026427673 7:70312651-70312673 GGAAAGGGTGGCCCCACACCAGG + Intronic
1026582788 7:71632194-71632216 GAAAAGCTTGGCCGGACACAAGG - Intronic
1039079731 8:33722786-33722808 GTGAAGGCTGTGCCTACACAGGG + Intergenic
1042213476 8:66404963-66404985 GAGGAGGCTGGACCTACAGAGGG - Intergenic
1044585021 8:93861343-93861365 GAAAGGGGTGGTCCCACACATGG + Intronic
1044892790 8:96855075-96855097 AAAAAGGCTGACCCTCCCCAAGG - Intronic
1046390879 8:113570914-113570936 GAAAAGGCAAGCCGTAGACAGGG - Intergenic
1047515984 8:125555160-125555182 CAAGAAGCTGGCCCTACACTTGG + Intergenic
1049145633 8:141000143-141000165 GAACAGGATGCCGCTACACAAGG + Intronic
1049298167 8:141854895-141854917 GAGAAGGCTTGTCCTGCACAGGG + Intergenic
1050653871 9:7802691-7802713 TAATAGGCTTGCTCTACACAGGG + Intronic
1051291659 9:15551982-15552004 GAAAAGACGGCCCCTACACCTGG + Intergenic
1052322251 9:27180653-27180675 GAAAAGGTTGGTCCTAGAGAAGG - Intronic
1055207574 9:73751281-73751303 AAATAGGCAGGCCCTACAGAGGG + Intergenic
1058579531 9:106439962-106439984 TAAAAAGCTGGCCCAACACTTGG + Intergenic
1058627942 9:106954543-106954565 GAAAAGGCTGGGTATAAACATGG - Intronic
1062046320 9:134426088-134426110 CAAGAGGCTGGCCCTTCCCAAGG - Intronic
1185863319 X:3599985-3600007 GAAAAAGCTGGCCCTGGAGAAGG - Intergenic
1186507245 X:10102940-10102962 GAGAAGGATGACCCTAAACAGGG + Intronic
1187413211 X:19069453-19069475 GAAGAGTGTGGCCCTAGACAAGG + Intronic
1190573353 X:51807691-51807713 GAAAAGGATGGCACTACAAAAGG - Intronic
1197751452 X:129966667-129966689 GAAAATGCTGTCTCAACACAAGG - Intergenic
1200061288 X:153484919-153484941 CAAAAGGCTGACCCTAGCCACGG + Intronic