ID: 1080421077

View in Genome Browser
Species Human (GRCh38)
Location 11:32110951-32110973
Sequence GGTGAGATAATGCATGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080421073_1080421077 6 Left 1080421073 11:32110922-32110944 CCTAGCTCCCAGAGTAGCTCTGC No data
Right 1080421077 11:32110951-32110973 GGTGAGATAATGCATGTGCAAGG No data
1080421074_1080421077 -1 Left 1080421074 11:32110929-32110951 CCCAGAGTAGCTCTGCAAATGAG No data
Right 1080421077 11:32110951-32110973 GGTGAGATAATGCATGTGCAAGG No data
1080421075_1080421077 -2 Left 1080421075 11:32110930-32110952 CCAGAGTAGCTCTGCAAATGAGG No data
Right 1080421077 11:32110951-32110973 GGTGAGATAATGCATGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080421077 Original CRISPR GGTGAGATAATGCATGTGCA AGG Intergenic
No off target data available for this crispr