ID: 1080423239

View in Genome Browser
Species Human (GRCh38)
Location 11:32132065-32132087
Sequence CTGCATCCATGTGGCTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080423239_1080423243 11 Left 1080423239 11:32132065-32132087 CCTTTAAAGCCACATGGATGCAG No data
Right 1080423243 11:32132099-32132121 TATCCTAAGCAAGTTAATGCAGG 0: 9
1: 194
2: 650
3: 2516
4: 3467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080423239 Original CRISPR CTGCATCCATGTGGCTTTAA AGG (reversed) Intergenic
No off target data available for this crispr