ID: 1080426959

View in Genome Browser
Species Human (GRCh38)
Location 11:32163885-32163907
Sequence ATTTGGTCCTGGGGCAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080426959_1080426963 -10 Left 1080426959 11:32163885-32163907 CCTGTGCTGCCCCAGGACCAAAT No data
Right 1080426963 11:32163898-32163920 AGGACCAAATTAACTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080426959 Original CRISPR ATTTGGTCCTGGGGCAGCAC AGG (reversed) Intergenic
No off target data available for this crispr