ID: 1080427357 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:32168449-32168471 |
| Sequence | CAGGCTGAGCAAAGCCAGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1080427350_1080427357 | 25 | Left | 1080427350 | 11:32168401-32168423 | CCAGTGGAAGTCTGGGTATAGGG | No data | ||
| Right | 1080427357 | 11:32168449-32168471 | CAGGCTGAGCAAAGCCAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1080427357 | Original CRISPR | CAGGCTGAGCAAAGCCAGGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||