ID: 1080427357

View in Genome Browser
Species Human (GRCh38)
Location 11:32168449-32168471
Sequence CAGGCTGAGCAAAGCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080427350_1080427357 25 Left 1080427350 11:32168401-32168423 CCAGTGGAAGTCTGGGTATAGGG No data
Right 1080427357 11:32168449-32168471 CAGGCTGAGCAAAGCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080427357 Original CRISPR CAGGCTGAGCAAAGCCAGGC TGG Intergenic
No off target data available for this crispr