ID: 1080433253

View in Genome Browser
Species Human (GRCh38)
Location 11:32217517-32217539
Sequence CAGGCGCCTGCCACTGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080433253_1080433256 -5 Left 1080433253 11:32217517-32217539 CCGGGACCAGTGGCAGGCGCCTG No data
Right 1080433256 11:32217535-32217557 GCCTGTAATCCCAGCTACTTGGG 0: 35616
1: 158937
2: 257753
3: 440394
4: 391946
1080433253_1080433258 -2 Left 1080433253 11:32217517-32217539 CCGGGACCAGTGGCAGGCGCCTG No data
Right 1080433258 11:32217538-32217560 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
1080433253_1080433260 4 Left 1080433253 11:32217517-32217539 CCGGGACCAGTGGCAGGCGCCTG No data
Right 1080433260 11:32217544-32217566 CCCAGCTACTTGGGAGGCTGAGG 0: 89011
1: 200457
2: 243521
3: 257984
4: 301655
1080433253_1080433262 8 Left 1080433253 11:32217517-32217539 CCGGGACCAGTGGCAGGCGCCTG No data
Right 1080433262 11:32217548-32217570 GCTACTTGGGAGGCTGAGGCAGG 0: 74529
1: 175606
2: 216051
3: 220891
4: 278507
1080433253_1080433255 -6 Left 1080433253 11:32217517-32217539 CCGGGACCAGTGGCAGGCGCCTG No data
Right 1080433255 11:32217534-32217556 CGCCTGTAATCCCAGCTACTTGG 0: 19859
1: 144299
2: 173844
3: 251438
4: 351339
1080433253_1080433263 30 Left 1080433253 11:32217517-32217539 CCGGGACCAGTGGCAGGCGCCTG No data
Right 1080433263 11:32217570-32217592 GAGAATCGCTTGAGCCCAAGAGG 0: 48
1: 2193
2: 35380
3: 114952
4: 179704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080433253 Original CRISPR CAGGCGCCTGCCACTGGTCC CGG (reversed) Intergenic
No off target data available for this crispr