ID: 1080434002

View in Genome Browser
Species Human (GRCh38)
Location 11:32223344-32223366
Sequence GGCAGATGACCTTCCTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080434002_1080434010 29 Left 1080434002 11:32223344-32223366 CCTCCACAGGAAGGTCATCTGCC No data
Right 1080434010 11:32223396-32223418 CCATGATCTGCTTTTATTTTAGG No data
1080434002_1080434011 30 Left 1080434002 11:32223344-32223366 CCTCCACAGGAAGGTCATCTGCC No data
Right 1080434011 11:32223397-32223419 CATGATCTGCTTTTATTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080434002 Original CRISPR GGCAGATGACCTTCCTGTGG AGG (reversed) Intergenic
No off target data available for this crispr