ID: 1080434011

View in Genome Browser
Species Human (GRCh38)
Location 11:32223397-32223419
Sequence CATGATCTGCTTTTATTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080434002_1080434011 30 Left 1080434002 11:32223344-32223366 CCTCCACAGGAAGGTCATCTGCC No data
Right 1080434011 11:32223397-32223419 CATGATCTGCTTTTATTTTAGGG No data
1080434005_1080434011 -8 Left 1080434005 11:32223382-32223404 CCAGTCCTACCCTTCCATGATCT No data
Right 1080434011 11:32223397-32223419 CATGATCTGCTTTTATTTTAGGG No data
1080434004_1080434011 9 Left 1080434004 11:32223365-32223387 CCTGCTTGCTCTTAGCTCCAGTC No data
Right 1080434011 11:32223397-32223419 CATGATCTGCTTTTATTTTAGGG No data
1080434003_1080434011 27 Left 1080434003 11:32223347-32223369 CCACAGGAAGGTCATCTGCCTGC No data
Right 1080434011 11:32223397-32223419 CATGATCTGCTTTTATTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080434011 Original CRISPR CATGATCTGCTTTTATTTTA GGG Intergenic
No off target data available for this crispr