ID: 1080436543

View in Genome Browser
Species Human (GRCh38)
Location 11:32249995-32250017
Sequence CCCGGCAGCCCAGTCATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080436543_1080436548 23 Left 1080436543 11:32249995-32250017 CCAGTGATGACTGGGCTGCCGGG No data
Right 1080436548 11:32250041-32250063 CTGCCTTCTCCCCTCCTCCCGGG No data
1080436543_1080436547 22 Left 1080436543 11:32249995-32250017 CCAGTGATGACTGGGCTGCCGGG No data
Right 1080436547 11:32250040-32250062 CCTGCCTTCTCCCCTCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080436543 Original CRISPR CCCGGCAGCCCAGTCATCAC TGG (reversed) Intergenic
No off target data available for this crispr