ID: 1080436597

View in Genome Browser
Species Human (GRCh38)
Location 11:32250366-32250388
Sequence ATGGAGAAGCAGGTTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080436597_1080436604 18 Left 1080436597 11:32250366-32250388 CCTCCCTGAACCTGCTTCTCCAT No data
Right 1080436604 11:32250407-32250429 TAACATAAAGTCCCAAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080436597 Original CRISPR ATGGAGAAGCAGGTTCAGGG AGG (reversed) Intergenic
No off target data available for this crispr