ID: 1080445207

View in Genome Browser
Species Human (GRCh38)
Location 11:32331855-32331877
Sequence CTGGGGGTGTGGGGGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080445199_1080445207 -7 Left 1080445199 11:32331839-32331861 CCAGTCCTGGTAGATGCTGGGGG No data
Right 1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080445207 Original CRISPR CTGGGGGTGTGGGGGGAATA TGG Intergenic
No off target data available for this crispr