ID: 1080451623

View in Genome Browser
Species Human (GRCh38)
Location 11:32382949-32382971
Sequence CACTCACCTCCTTTTGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080451623_1080451625 -3 Left 1080451623 11:32382949-32382971 CCACTATCAAAAGGAGGTGAGTG No data
Right 1080451625 11:32382969-32382991 GTGGAGAGACTGCATGTAAATGG No data
1080451623_1080451626 15 Left 1080451623 11:32382949-32382971 CCACTATCAAAAGGAGGTGAGTG No data
Right 1080451626 11:32382987-32383009 AATGGAGAATGCATGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080451623 Original CRISPR CACTCACCTCCTTTTGATAG TGG (reversed) Intergenic
No off target data available for this crispr