ID: 1080451625

View in Genome Browser
Species Human (GRCh38)
Location 11:32382969-32382991
Sequence GTGGAGAGACTGCATGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080451623_1080451625 -3 Left 1080451623 11:32382949-32382971 CCACTATCAAAAGGAGGTGAGTG No data
Right 1080451625 11:32382969-32382991 GTGGAGAGACTGCATGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080451625 Original CRISPR GTGGAGAGACTGCATGTAAA TGG Intergenic
No off target data available for this crispr