ID: 1080454865

View in Genome Browser
Species Human (GRCh38)
Location 11:32408948-32408970
Sequence GAATTCCTAGGGAATACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080454865_1080454869 3 Left 1080454865 11:32408948-32408970 CCAGGAGTATTCCCTAGGAATTC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1080454869 11:32408974-32408996 GTGGTTATGCCACAGTGCTTAGG 0: 1
1: 0
2: 0
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080454865 Original CRISPR GAATTCCTAGGGAATACTCC TGG (reversed) Intronic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
907497397 1:54853986-54854008 GGATTCCAAGGGAATGCACCTGG + Intronic
909884169 1:80919919-80919941 GAAGTTCGAGGGCATACTCCTGG + Intergenic
911515548 1:98864326-98864348 GAAATCCTAGAGAAAACTGCTGG - Intergenic
920577713 1:207074005-207074027 GCAATTCTAAGGAATACTCCTGG - Exonic
920767135 1:208844075-208844097 GAACACCTAGAGAATACTCATGG + Intergenic
920965076 1:210694588-210694610 AAATTCCCAGGGAATCCCCCTGG + Intronic
923382240 1:233432955-233432977 GAAAACCTAGGGAAAACTCTTGG - Intergenic
1063439251 10:6059101-6059123 GAATTTCTAGGCATCACTCCAGG - Intronic
1065012976 10:21436233-21436255 AAGTTCCTATGGAATATTCCTGG + Intergenic
1070389676 10:75958537-75958559 GAACTCTTAGGGGATGCTCCAGG - Intronic
1071731808 10:88255766-88255788 GAATTCCTAGCCAATCATCCAGG + Intergenic
1074200633 10:111231781-111231803 GGATTCCTAGGGAAGAGTCAGGG + Intergenic
1078377171 11:10806024-10806046 GAGTTCCTGGGGAAAACCCCAGG - Exonic
1080454865 11:32408948-32408970 GAATTCCTAGGGAATACTCCTGG - Intronic
1080957442 11:37115907-37115929 GAATTCCTAAGGCACTCTCCAGG + Intergenic
1081053842 11:38383354-38383376 GAATTCCCAGTGAATAGTACTGG + Intergenic
1083487237 11:62991252-62991274 GAGTTCCTAGGAAAGATTCCTGG + Intronic
1086328198 11:85726174-85726196 AAATTCAAAGGGCATACTCCAGG - Intronic
1087989502 11:104730714-104730736 TTATTCCTAGGGAATATTTCAGG - Intergenic
1089074466 11:115727228-115727250 GAGTTCCTAGGAAGGACTCCAGG - Intergenic
1091003151 11:131927822-131927844 AAATTCATAGGGTAGACTCCTGG - Intronic
1094339152 12:29391106-29391128 AAATTCATAGGAAATACTTCTGG + Intergenic
1095169510 12:39018227-39018249 GAATTTCTTGGCAATACTCTGGG + Intergenic
1108843930 13:54655094-54655116 TAATTCCTAGGTTATCCTCCAGG - Intergenic
1111121506 13:83857266-83857288 TTATTACCAGGGAATACTCCAGG + Intergenic
1112602453 13:100869775-100869797 GAATTTTTAGCAAATACTCCAGG + Intergenic
1115408908 14:33050387-33050409 GAAGACCTAGGGAAGACTGCTGG - Intronic
1120224183 14:81771747-81771769 AAATTCTGAGGGGATACTCCTGG - Intergenic
1122140487 14:99660201-99660223 GAATCCCTCCGGAATTCTCCTGG + Intronic
1132926188 16:2430153-2430175 GACTTCCTAGCGATTGCTCCCGG - Intronic
1141608239 16:85167758-85167780 GAATCCCTGGGGGATATTCCAGG - Intergenic
1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG + Intronic
1156772498 18:40746500-40746522 GAATTCCTAGTATATACTACTGG + Intergenic
1160758112 19:768617-768639 GAATTCCTAGTGAAATTTCCAGG + Intergenic
1165317027 19:35062475-35062497 TAAGACCAAGGGAATACTCCAGG - Intronic
1166092047 19:40515690-40515712 AAAGTGCTTGGGAATACTCCTGG - Intronic
1166465663 19:43028162-43028184 GCATCCCTTGGGAAGACTCCAGG + Intronic
925269415 2:2591687-2591709 CAATACCCAGGGAGTACTCCAGG + Intergenic
925330226 2:3052971-3052993 GAGTTCCTGGGGAACACTGCCGG + Intergenic
929028982 2:37633413-37633435 AATTTCCTGAGGAATACTCCAGG + Intergenic
930213594 2:48669854-48669876 GAATTTCTAGGGAATATTGACGG + Exonic
931796819 2:65719063-65719085 GAATCCCTAGGAAACAGTCCAGG + Intergenic
932752070 2:74377590-74377612 GAAGTCCTGGGGACTCCTCCTGG + Intronic
935046398 2:99487375-99487397 GAATCCCTAGGGAACAGTCAGGG + Intronic
935900031 2:107781752-107781774 GAATTCCAGGGGAACATTCCAGG - Intergenic
938585906 2:132690510-132690532 GAGTTCCTAGGGCATATTCCTGG - Intronic
944601548 2:201308556-201308578 GAATTTGTAGAGACTACTCCAGG - Intronic
945926659 2:215812362-215812384 GGATTCCTAGGCAATACTTATGG + Intergenic
1170738538 20:19032104-19032126 AAGTTCCTAAGGAATACTTCTGG + Intergenic
1172698745 20:36839773-36839795 GCATTCCTCGGGAAGGCTCCAGG - Intronic
1177152299 21:17467098-17467120 TAATTCCCAGGGAATTCTCCTGG - Intergenic
1177175246 21:17695470-17695492 GAATTTCTTGGGAAGATTCCGGG + Intergenic
1177926635 21:27224338-27224360 GTATTCCTAGGATATACTGCTGG + Intergenic
1178716870 21:34972956-34972978 GAATTCCAAGGAAATAGTTCTGG - Intronic
1182833786 22:33325084-33325106 GAATTCAGAGGAAATACACCTGG - Intronic
957821279 3:85377419-85377441 AAATTCATAGGTAATGCTCCAGG + Intronic
958842098 3:99218581-99218603 GATAATCTAGGGAATACTCCTGG + Intergenic
961476955 3:127153003-127153025 GAATTCCCAGGGAACAAGCCAGG - Intergenic
963381873 3:144540846-144540868 GAATTCCTAGGTTATCTTCCAGG - Intergenic
963755571 3:149231942-149231964 GAAGTCCTAGGGCCTAGTCCGGG + Intergenic
971699694 4:29955094-29955116 GCATCCCTAGGAAATACTGCAGG + Intergenic
972022893 4:34336986-34337008 GAAAACCTAGGGAAAACTTCTGG - Intergenic
975979742 4:80144040-80144062 AAATTCCCAGGCAGTACTCCTGG + Intergenic
976091237 4:81460333-81460355 GAATTCCTAGGGACGGCACCCGG + Intronic
978309088 4:107365806-107365828 TTATTCCTAGAGATTACTCCAGG + Intergenic
984619775 4:181939369-181939391 GGATTCCTAGGAAAAGCTCCTGG + Intergenic
986000121 5:3623816-3623838 AAATTCCTTGGGACTACTCTTGG - Intergenic
986016334 5:3760809-3760831 GAATCCAGAGGGAAGACTCCAGG + Intergenic
992736605 5:79728010-79728032 AAATGCTTAGGGAATATTCCTGG - Intronic
993174689 5:84468772-84468794 GAAATTCTAGGGAATTCTACAGG - Intergenic
996557475 5:124793972-124793994 CAAATCCTTGGGAATACTGCAGG + Intergenic
999795805 5:154988795-154988817 GATTCCCTAGAGAAAACTCCAGG - Intergenic
1007391259 6:41550755-41550777 GAGTGCCTGGGGAATGCTCCAGG - Intronic
1007887867 6:45252873-45252895 GCATTCCTATGGATTATTCCTGG + Intronic
1011124290 6:83989655-83989677 GAAAACCTAGGCAATACTCAAGG + Intergenic
1012746544 6:103097648-103097670 CAATTCCTAGAGAGTGCTCCTGG - Intergenic
1018929637 6:168232455-168232477 GAATTACTTGGGAATACTCACGG + Intergenic
1022043566 7:26603809-26603831 GAATTCCAAGGGAGAACACCTGG + Intergenic
1024091431 7:45944930-45944952 TAATTTCTAGGAAATACTACAGG - Intergenic
1027804247 7:82796245-82796267 AAATTCCCAGTGAATAATCCAGG + Intronic
1029789977 7:102832298-102832320 GATTTCCTATAGAATTCTCCAGG - Intronic
1038711413 8:29950314-29950336 GTATTCCCAGGGCATACTCCAGG - Intergenic
1043106985 8:76126154-76126176 GAAATCCTAGGGGAGACCCCTGG + Intergenic
1047532343 8:125688167-125688189 GAATTCCCTGGGCATTCTCCAGG + Intergenic
1047623998 8:126636792-126636814 GGCTTCCTCGGGAATACTGCAGG + Intergenic
1058620040 9:106873140-106873162 GAACTCCAAGGATATACTCCTGG - Intronic
1059092844 9:111379235-111379257 GAATACCTTGGGGATACTGCAGG + Intronic
1060285885 9:122251992-122252014 GAATTCCCAGAGCATACTCATGG - Intronic
1060671767 9:125476057-125476079 GAATTCCTATGGAGTAACCCAGG - Intronic
1185944622 X:4361180-4361202 TGATTCCTAGGGAATATTTCTGG - Intergenic
1187208855 X:17209346-17209368 AAAGTCCTAGGCAAAACTCCTGG - Intergenic
1188443580 X:30234565-30234587 GTATTCCCAGGGAAGACTTCCGG - Intronic
1188482295 X:30648328-30648350 GTATTCCCAGGGAATACTTTGGG - Intergenic
1189134417 X:38533817-38533839 GAATTCCTTGGGAAATCTGCAGG + Intronic
1189135159 X:38541533-38541555 GAGTTCCTATGGCATACTTCTGG + Intronic
1189490667 X:41469313-41469335 GAATTCCTAGCAAATACCCCTGG - Intronic
1192564437 X:72151853-72151875 GATTTCCTAGGGAAATCACCAGG + Intergenic
1194447867 X:94009269-94009291 AAATGCCTAGGGAAGACTCTTGG + Intergenic