ID: 1080456276

View in Genome Browser
Species Human (GRCh38)
Location 11:32422417-32422439
Sequence AATGATAGGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 380}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080456276_1080456283 15 Left 1080456276 11:32422417-32422439 CCTTCCACCTTCTGCCTATCATT 0: 1
1: 0
2: 3
3: 40
4: 380
Right 1080456283 11:32422455-32422477 TGATTTTCTACTAAGGGAAAAGG 0: 1
1: 0
2: 1
3: 27
4: 326
1080456276_1080456281 8 Left 1080456276 11:32422417-32422439 CCTTCCACCTTCTGCCTATCATT 0: 1
1: 0
2: 3
3: 40
4: 380
Right 1080456281 11:32422448-32422470 CAAATATTGATTTTCTACTAAGG 0: 1
1: 0
2: 3
3: 45
4: 411
1080456276_1080456282 9 Left 1080456276 11:32422417-32422439 CCTTCCACCTTCTGCCTATCATT 0: 1
1: 0
2: 3
3: 40
4: 380
Right 1080456282 11:32422449-32422471 AAATATTGATTTTCTACTAAGGG 0: 1
1: 0
2: 3
3: 54
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080456276 Original CRISPR AATGATAGGCAGAAGGTGGA AGG (reversed) Intronic
900494757 1:2971386-2971408 AATGATAGCAAGAAGGTGGCTGG - Intergenic
900691009 1:3980606-3980628 AAGGATGGGCAGATGATGGATGG - Intergenic
900974902 1:6010878-6010900 AATGAGTGGCAGGAGGTGCATGG + Intronic
901006840 1:6175931-6175953 ATTGATAGGCGGATGGTGAACGG + Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901800046 1:11703335-11703357 AAGGATGGGCAGGACGTGGACGG + Intronic
902778921 1:18692199-18692221 AAGAAAAGGAAGAAGGTGGAAGG + Intronic
902826270 1:18976452-18976474 AATCCCAGGCAAAAGGTGGAAGG + Intergenic
905661350 1:39728445-39728467 AATGATACGGAAAAGGGGGAGGG - Intronic
905885505 1:41489686-41489708 ATGGATAGAAAGAAGGTGGATGG - Intergenic
905885551 1:41489884-41489906 ATGGATAGAAAGAAGGTGGATGG - Intergenic
906154643 1:43606746-43606768 ATTAATAGGCAGAGGGTGGGGGG + Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907971848 1:59390795-59390817 AATGATAGTCACAAGGTAAAGGG + Intronic
908044069 1:60149364-60149386 AATGAATGGCAGCAGGTGGCAGG - Intergenic
908870571 1:68606364-68606386 AATGATATTTAGTAGGTGGATGG + Intergenic
910176456 1:84436039-84436061 AAGGATGGGCTGAAGGGGGAAGG + Intergenic
910680668 1:89860952-89860974 AAAGATAGGTAGAAGTTGCAGGG + Intronic
911310701 1:96289065-96289087 AATGGCAGTCAGAAGGGGGATGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
913565044 1:120065023-120065045 AGTGAGAGGCAGGGGGTGGATGG + Intronic
913633082 1:120728534-120728556 AGTGAGAGGCAGGGGGTGGATGG - Intergenic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
915038218 1:152946472-152946494 AATGATTATCATAAGGTGGAGGG - Intergenic
915438256 1:155925764-155925786 AATGTCAAGGAGAAGGTGGAAGG - Exonic
916450652 1:164917331-164917353 AATAAAAGGCAGAAGATGAATGG + Intergenic
916898838 1:169198726-169198748 AATGATAGCCAAAAGGTATAGGG + Intronic
917783073 1:178420484-178420506 AAGGAAAGGCAGAAGGTGATGGG - Intronic
918550806 1:185740066-185740088 AGTGATAGGAAGAAGTTAGAGGG + Intronic
919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG + Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921164189 1:212494316-212494338 AATGGCAGGCAGGAGGTGGCGGG + Intergenic
923427253 1:233883446-233883468 AATGGTAGCAAGAAGTTGGAAGG + Intergenic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063069151 10:2642214-2642236 TATGACAGTCAGAAGGTGGTGGG + Intergenic
1064644316 10:17445516-17445538 AAAGAAAGGCAGACGGTGGGAGG - Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1065070239 10:22015670-22015692 GATGAGAGACAGAAGGTGGGGGG + Intergenic
1065471458 10:26086173-26086195 AATCGTGGGCAGAAGGTGAAGGG + Intronic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1067066460 10:43106696-43106718 AGTGCTGGGCAGAGGGTGGAGGG - Intronic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068547624 10:58367071-58367093 AATGACAGGCAAAGGGTGGGGGG - Intronic
1069841299 10:71341080-71341102 AATGAGAGGCAGGAGCTGGAAGG - Intronic
1069858766 10:71457138-71457160 TTTGATAGGCTGAAGCTGGAGGG + Intronic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1073136684 10:101224342-101224364 AATAAAAGGCAGAAGGGGAAGGG + Intergenic
1073805545 10:107093770-107093792 AGTGATAGGCAGATTGTGTAAGG - Intronic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1076422581 10:130341627-130341649 AATGGAAGGCTGGAGGTGGAGGG + Intergenic
1077159513 11:1106311-1106333 GATGGTAGACAGATGGTGGATGG - Intergenic
1077159524 11:1106357-1106379 GATGGTAGACAGATGGTGGATGG - Intergenic
1077329402 11:1977337-1977359 AATGACAGCCAGAGGCTGGAAGG + Intronic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1078950301 11:16124441-16124463 AATGAAAGGCAGAAAGTTGGAGG + Intronic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079083580 11:17430197-17430219 AATGAAAGCCTGAAGGTAGAAGG - Intronic
1080132808 11:28816314-28816336 GGTGATAGGCTGAAGGTTGAAGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080718888 11:34830303-34830325 AATGTAAGGCAGAAGCTGGGGGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081575772 11:44317807-44317829 AATGAAAGGGAGGAGGGGGAAGG - Intergenic
1082943076 11:58728412-58728434 ACTGAGGGGCATAAGGTGGAAGG - Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1085879404 11:80448214-80448236 AAGGATAGGGAGAAGGGGAATGG - Intergenic
1086203780 11:84234346-84234368 ACTGATGGGCAGAAGGCAGAAGG - Intronic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087129988 11:94660457-94660479 ACTGAGAGGCAGATGCTGGATGG - Intergenic
1088269982 11:108024190-108024212 AATTATAGGCAGTAAGTGGCAGG - Intronic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088953958 11:114599407-114599429 GATAACAGGCAGAGGGTGGAGGG - Intergenic
1089023102 11:115238675-115238697 AGTGATTGTGAGAAGGTGGACGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091032826 11:132206303-132206325 AATGACAGCCAGATGATGGAAGG - Intronic
1091192840 11:133708717-133708739 AGTCAGAGGCACAAGGTGGAGGG - Intergenic
1091358464 11:134956215-134956237 ATTGATGGGCAGAGGGTGAAGGG + Intergenic
1202812382 11_KI270721v1_random:32516-32538 AATGACAGCCAGAGGCTGGAAGG + Intergenic
1091441320 12:513096-513118 GAAGGAAGGCAGAAGGTGGAAGG - Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1092228528 12:6764447-6764469 AAAAATAGGAGGAAGGTGGATGG + Intronic
1093463948 12:19431486-19431508 AAAGATAGGCAAAATGTGAAAGG - Intronic
1094070187 12:26404197-26404219 AACTGTAGGCAGAAGGGGGAAGG + Intronic
1095360632 12:41334234-41334256 AATGAAAGGCAGAAGCAAGAAGG - Intronic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1101289340 12:103351935-103351957 AAAGAGAGGAAGAGGGTGGAGGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102398600 12:112609488-112609510 AACAATAGGCAGGAGGTGGAAGG - Intronic
1102446281 12:113005253-113005275 GATGGTGGACAGAAGGTGGAGGG + Intronic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1102782412 12:115576539-115576561 AATGAAAGGAAGACAGTGGAGGG - Intergenic
1105510544 13:21048500-21048522 TATGGTAGGTAGAGGGTGGATGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105742730 13:23345369-23345391 ACTGCTAGGCTGGAGGTGGAGGG - Intronic
1106128350 13:26919808-26919830 AATGATTGGCAGTAGTTGGCTGG - Intergenic
1106694884 13:32162706-32162728 ATTGGCAGCCAGAAGGTGGAAGG - Intronic
1108562869 13:51664047-51664069 AATGAAAGGAAGAAAGTGGAAGG + Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1108821751 13:54359324-54359346 AATGGGAGGTAGGAGGTGGAAGG - Intergenic
1109150506 13:58842090-58842112 AATTACAGCAAGAAGGTGGAGGG - Intergenic
1109201707 13:59438583-59438605 AATGGTAGTCAAAATGTGGAAGG - Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1110405826 13:75149461-75149483 AAAGATGGGCAGCAGCTGGAGGG - Intergenic
1110539161 13:76688466-76688488 AATAATAGGCACATGGTGCATGG + Intergenic
1110740872 13:78995238-78995260 AAAGATAGGAAGTAGATGGAGGG + Intergenic
1111608972 13:90578732-90578754 AATAATGGGTAGAAGCTGGAAGG - Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1112240430 13:97676289-97676311 AGTGCCAGGTAGAAGGTGGATGG - Intergenic
1113427423 13:110220675-110220697 AATGATAGTCAGAAGGAGGACGG - Intronic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114150319 14:20031272-20031294 AATGGCAGGCAGAAGGAGGGCGG + Intergenic
1116299819 14:43164328-43164350 AATGAAAGTCAGATGGGGGAAGG + Intergenic
1116693562 14:48142730-48142752 AATGGATGGCAGAAGCTGGAAGG - Intergenic
1117431963 14:55675883-55675905 AATGAAAGACAGAAGGTAGCTGG + Exonic
1118172349 14:63400091-63400113 AATGATAGATGGATGGTGGATGG - Intronic
1118464877 14:66021999-66022021 AATGGAAGCCAGCAGGTGGAGGG + Intergenic
1118495495 14:66304595-66304617 AATGATAGGAAAAAGGTAGGAGG - Intergenic
1119009092 14:70965152-70965174 AATGATGGGTAGAAGATGAAAGG - Intronic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1121240996 14:92430135-92430157 AAAGTTACTCAGAAGGTGGAAGG - Intronic
1123798434 15:23797396-23797418 GATGATAGGTAGGTGGTGGATGG + Intergenic
1124805863 15:32882045-32882067 ATTGACAGGCAGGAGGTGGAAGG + Intronic
1127406610 15:58655349-58655371 AAGCATGGGCAGAAGGTGAAGGG + Intronic
1128732351 15:70029751-70029773 ACTGCTTGGCAGAAGGTGAAAGG + Intergenic
1129491142 15:75926742-75926764 AAGGATAGGCATGAGGTGAATGG + Intronic
1130366357 15:83243358-83243380 AAAGAAAGGAAGAAGATGGAAGG + Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131771495 15:95742752-95742774 AATGAGAGACAGAAGATGTAAGG - Intergenic
1131781806 15:95867819-95867841 AATGACTGGCAGGAGATGGAGGG + Intergenic
1131874219 15:96787597-96787619 GATGATAGGTAGAAGATAGATGG + Intergenic
1132035795 15:98483112-98483134 AATGCTATGAAGAATGTGGATGG - Intronic
1133448050 16:5879276-5879298 GATGGTAAGCAGAAGCTGGAGGG + Intergenic
1133600289 16:7333664-7333686 AATGATGGCAAGAAAGTGGAGGG + Intronic
1134477892 16:14591654-14591676 AAGGATGGGCTGAAGGTTGAAGG + Intronic
1134632233 16:15765130-15765152 GATGGTAGGTGGAAGGTGGATGG + Intronic
1135939591 16:26809742-26809764 AATGCAAGGGAGAAGGAGGAAGG + Intergenic
1138948385 16:61880259-61880281 AATGATAATCTGAAGCTGGAAGG + Intronic
1139256373 16:65546796-65546818 AATGATAGAAATGAGGTGGAGGG + Intergenic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1140329581 16:74041171-74041193 AATGATAGGTAAAAAGAGGATGG - Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1142264856 16:89058938-89058960 ACTGATGGGCAGAAGGTCAAGGG - Intergenic
1143374428 17:6458902-6458924 AAGGACAGGAAGAAGATGGAAGG - Intronic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143663045 17:8339064-8339086 AAAGGGAGGCAGAAGCTGGAGGG + Intergenic
1144363642 17:14520912-14520934 AATGGAGGGCAGAAGGTGGGAGG - Intergenic
1145246583 17:21273633-21273655 AGTCATAGGCAGAGGCTGGATGG + Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1147615635 17:41825666-41825688 AATGAGAGGCAGAAGCCAGAGGG + Intronic
1149219366 17:54398377-54398399 AAAGAATGGCAGAAGGTGAAGGG - Intergenic
1149909893 17:60557571-60557593 ACTGATAGGTAGAAGGTGGTGGG - Intergenic
1150570993 17:66387219-66387241 AATGCTAGGCTGCAGGTAGATGG + Intronic
1150776663 17:68086888-68086910 AAGGAGAGGGAGAAGGTTGAGGG - Intergenic
1150924860 17:69522209-69522231 AATAATAGGCACACTGTGGAAGG - Intronic
1150972324 17:70042837-70042859 AGTGATAGGTAGTAGCTGGAAGG - Intergenic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1153448213 18:5197091-5197113 AAAGACAGGCAGACGGAGGATGG + Exonic
1153468359 18:5415296-5415318 AATGATGAGCAGAGGGTGGTGGG + Intronic
1153944562 18:10007795-10007817 AATAAAAGGCAGCAGCTGGAGGG - Intergenic
1154496481 18:14965003-14965025 ATTGATGGGCAGAGGGTGAAGGG - Intergenic
1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG + Intergenic
1155437206 18:25826087-25826109 AATGACAGGCAGTGGGTGGAGGG - Intergenic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1156724485 18:40111696-40111718 AAAGATAGGAAAAAGGAGGAGGG - Intergenic
1156821073 18:41373657-41373679 AACAATAGGAAGAGGGTGGATGG + Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1160692499 19:466406-466428 AAGGTTAGGTAGATGGTGGATGG + Intronic
1161287677 19:3477303-3477325 GATGATAGACAGATGGTGGGTGG + Intronic
1161760221 19:6165754-6165776 AATGATCCTCAGCAGGTGGAAGG - Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162583394 19:11544443-11544465 ACTGAGAGTCAGATGGTGGAGGG + Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1164436168 19:28231617-28231639 AATGACAGACAGAAGTTGGTGGG - Intergenic
1165790187 19:38486662-38486684 AAAGATAGGGAGATGGTGGGAGG - Intronic
1167369269 19:49071216-49071238 AAAGCTAGGCACAAGGTGGTGGG - Intronic
925234902 2:2269537-2269559 AATGCAAGGCAGAAGTAGGATGG - Intronic
926618351 2:15021949-15021971 AATTGTAGGCAGAAGGCAGAAGG + Intergenic
926837211 2:17036279-17036301 AATGATAGGCAGATAGAAGAAGG + Intergenic
929100584 2:38308458-38308480 AAAGGTAGTCAGAGGGTGGAGGG + Intronic
929483916 2:42338285-42338307 AAGGAAAGGCAGAGGCTGGATGG - Intronic
929847436 2:45544449-45544471 AATCAGAGGCAGTAGGTGGCAGG + Intronic
929868232 2:45736348-45736370 CATGATAGGCGGGAGTTGGAAGG + Intronic
930653148 2:53982580-53982602 AATTCTAGGCAGTGGGTGGAAGG - Intronic
930923332 2:56784543-56784565 AAAGACAGGGAAAAGGTGGATGG - Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
933141126 2:78793856-78793878 AGTGAGAGGCTGAAGCTGGATGG + Intergenic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
936578912 2:113678657-113678679 ATTGATAGAAAGAAGGTTGATGG + Intergenic
937509419 2:122577328-122577350 AAAGAAAGGCAGAAACTGGAAGG + Intergenic
939956189 2:148529453-148529475 AAGGAGAGGCTGAAGGTGCACGG - Intergenic
940041874 2:149369640-149369662 AATGATAGGAAGACAGTGGCAGG + Intronic
941545555 2:166846232-166846254 AATGGGAGGTAGAAGGTAGAAGG + Intergenic
941904821 2:170710638-170710660 AAAGAAAGGAAGAAGGTGAAGGG - Intergenic
942152909 2:173096015-173096037 AATGATAGGCACTAGATGGTAGG - Intronic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
945127984 2:206534792-206534814 AATGATAGTAATAAGGTAGAGGG - Intronic
945403842 2:209422461-209422483 AATCATAGACAGTATGTGGATGG - Intergenic
947196278 2:227571219-227571241 AATAACAGGCAGAAACTGGAGGG + Intergenic
947219290 2:227777735-227777757 AAGGAAAGAAAGAAGGTGGAAGG - Intergenic
948689603 2:239693740-239693762 AATATTAGGGAGAAGATGGAGGG - Intergenic
949061033 2:241957443-241957465 GGTGAGAGCCAGAAGGTGGAGGG + Intergenic
1170803479 20:19610168-19610190 AATGATAAGAAGGAAGTGGAAGG - Intronic
1172193337 20:33075473-33075495 AAGGATGGGCAGGAGGGGGATGG - Intergenic
1172231153 20:33337073-33337095 AAAGGAAGGCTGAAGGTGGAGGG + Intergenic
1172869250 20:38125667-38125689 AAGGAGGGGCAGAGGGTGGAAGG - Intronic
1172946118 20:38690783-38690805 GATGATTGGCAGATGGAGGAAGG - Intergenic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1174199278 20:48795686-48795708 AATGGTAGGCAGAAGTCAGAAGG + Intronic
1174516780 20:51098673-51098695 AATAAAAGGCAGGGGGTGGAGGG - Intergenic
1174546549 20:51329903-51329925 AATGATAGGTAGATGATGGATGG + Intergenic
1174671947 20:52316631-52316653 GATGAGAGGGAAAAGGTGGAGGG + Intergenic
1174925116 20:54750739-54750761 TACAATAGGCAGAAGGTGAAGGG + Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175118555 20:56701337-56701359 AAAGAAGGGAAGAAGGTGGAGGG - Intergenic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1177860657 21:26449437-26449459 AATGATAGGCAGACGGTGCTTGG + Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178123086 21:29489249-29489271 AATGAGGGGCAGAAGGCAGAAGG - Intronic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1178598317 21:33974660-33974682 AAGGAAAGGAAGAAGGGGGATGG - Intergenic
1178660740 21:34505506-34505528 AAAGAGAGGCAGAGGCTGGAGGG + Intergenic
1178922169 21:36745869-36745891 AACCCCAGGCAGAAGGTGGAAGG + Intronic
1181387973 22:22558550-22558572 AAAGAAAGTCAGAAGGTGGGGGG + Intronic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181425445 22:22834681-22834703 AATGAAGGGCAGGAGGTAGAAGG - Intronic
1181429689 22:22871552-22871574 AATGAAGGGCAGTAGGTAGAAGG - Intronic
1181671198 22:24426331-24426353 AAGGACAGACAGAAGATGGATGG + Intronic
1181702024 22:24626872-24626894 AGTGATAGGCAGAGAGTGAATGG - Intronic
1181923395 22:26338362-26338384 AATGATGGGGAGAAGGCAGAGGG - Intronic
1182990068 22:34759182-34759204 ATGGATAGGAAGAAAGTGGAAGG + Intergenic
1185224399 22:49644572-49644594 AATGATGGGTGGATGGTGGATGG + Intronic
1185224408 22:49644603-49644625 AATGATGGGTGGATGGTGGATGG + Intronic
1185224422 22:49644658-49644680 AATGATGGGTGGATGGTGGATGG + Intronic
1185224466 22:49644823-49644845 AATGATGGGTGGATGGTGGATGG + Intronic
1185224487 22:49644900-49644922 AATGATGGGTGGATGGTGGATGG + Intronic
1185224519 22:49645017-49645039 AATGATGGGTGGATGGTGGATGG + Intronic
1185224543 22:49645104-49645126 AATGATGGGTGGATGGTGGATGG + Intronic
1185224551 22:49645135-49645157 AATGATGGGTGGATGGTGGATGG + Intronic
1185224577 22:49645221-49645243 AATGATGGGTGGATGGTGGATGG + Intronic
1185224593 22:49645290-49645312 AATGATGGGTGGATGGTGGATGG + Intronic
949359149 3:3213507-3213529 AATGATAAGCAAAATTTGGACGG + Intergenic
950009703 3:9714099-9714121 AAAGATAGGTGGTAGGTGGAAGG + Intronic
952502785 3:33979496-33979518 AAAGCTAGGCACAAGTTGGATGG - Intergenic
952556380 3:34535797-34535819 AATGCTAGGTAGAAGGTTGATGG - Intergenic
953143879 3:40254938-40254960 AATGATAGGGAGGAAGAGGAAGG - Intronic
953833816 3:46326191-46326213 AAAGATAGTGAGAAGGGGGATGG - Intergenic
954293105 3:49660136-49660158 AATGTGAGGCAGAGGGTGGCAGG + Intronic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
957130972 3:76222260-76222282 ACTGAGAGGCATAAGGTAGAAGG + Intronic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
958114345 3:89196026-89196048 AATGACTGGGAGAAGGAGGAAGG - Intronic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
960348061 3:116559294-116559316 AAAGATAGGAAGAAGGCTGAAGG + Intronic
960655686 3:120001459-120001481 AATCATGGGCAGAAGGTGAAGGG - Intronic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962045576 3:131756545-131756567 AATGAATGGCAGAAGATAGATGG + Intronic
962916221 3:139906219-139906241 AATGAGAGCAAGAAAGTGGAAGG - Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
966095757 3:176200804-176200826 AATGAGGGGCAGCAGGTGGCAGG + Intergenic
966095806 3:176201605-176201627 AATGAGGGGCAGCAGGTGGCAGG - Intergenic
966513938 3:180796140-180796162 AATCATTGGCAGAAGGTAAAAGG - Intronic
966701304 3:182854840-182854862 AAAAATGGGCAAAAGGTGGAAGG + Intronic
967032117 3:185617624-185617646 AATGATAGCCAAAAGGGGGAGGG - Intronic
967111587 3:186298399-186298421 AATGAGAGGCACAGGGTGCAGGG + Intronic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
967949196 3:194827768-194827790 AATGTAAGGCAGCAGGTAGAAGG - Intergenic
970816893 4:20167382-20167404 AATAAAAGACAGAAGATGGATGG + Intergenic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971145896 4:23976127-23976149 AATGAAGGGCAGAATGTGCAAGG + Intergenic
974175026 4:58310319-58310341 AATACTAGGCAGAAAGTGGTGGG - Intergenic
974269731 4:59634416-59634438 AATTGGAGGCAGAAGGTGAAAGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
975997406 4:80332217-80332239 TATGTTGGGCAGAAAGTGGAAGG + Intronic
976267255 4:83195755-83195777 AAAGAAAGGAAGAAGGTGGAAGG - Intergenic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
978290341 4:107130389-107130411 ACTGAAAGGCAGAAGGTAGCAGG + Intronic
980093071 4:128462375-128462397 AATGATGTGCAGGAGGTGGGTGG + Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
980955755 4:139427690-139427712 AATCATGGCCAGAAGGTGAAGGG + Intergenic
981724559 4:147833986-147834008 AAAGATAGGCAGAACGTGGGAGG - Intronic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
985993751 5:3584819-3584841 AATGAAAGGAAGAAGGGGGGAGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987771862 5:22315426-22315448 AACGAGAGGAAGAAGGTTGATGG + Intronic
988092137 5:26556798-26556820 AAAGATAGGCATAACGTTGAAGG - Intergenic
988698537 5:33649009-33649031 AATGAAAGGCTGAAGGTAAAGGG - Intronic
989157606 5:38359075-38359097 ATTCTTAGGCAGAAGGGGGAAGG - Intronic
989183210 5:38598530-38598552 AATGTTAGGTAGAATGTGGCAGG - Intronic
990136174 5:52646026-52646048 AAAGAAAGGGAGAAGGGGGATGG - Intergenic
990904068 5:60784198-60784220 AATGAAATGAAGAAGCTGGAAGG + Intronic
991048237 5:62245262-62245284 ACTGATGGGCAGAAGGCAGAAGG - Intergenic
994333593 5:98537861-98537883 AATGAGAGGCAAAAGGTTGCAGG + Intergenic
994830071 5:104770409-104770431 AATGATAGGAAGAAGAGTGATGG + Intergenic
995486685 5:112646813-112646835 AATGATAGGCCTATGGTGGTAGG - Intergenic
995554074 5:113309823-113309845 AATGAAAGAAAGAAGGTGAAAGG - Intronic
995878727 5:116820239-116820261 AATGATTAGAAGAAGGTAGATGG + Intergenic
996001700 5:118371796-118371818 AATGATAGCAAGAAAGTAGATGG + Intergenic
996018404 5:118566522-118566544 AAAGATAGGCTGGAGGTGAATGG - Intergenic
998754203 5:145358256-145358278 TATGAGAGGGAGGAGGTGGATGG + Intergenic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999218804 5:149958252-149958274 AATCAAAGGCAGCGGGTGGAGGG - Intergenic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1001108413 5:168875333-168875355 AATGAAAGGAGGAAGGTGGCCGG + Intronic
1001163246 5:169340037-169340059 AATGATTGTCAGATGGTGGCTGG - Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1003923216 6:10853115-10853137 AAAGTTAGGTAGAAAGTGGAGGG - Intronic
1004791751 6:19034400-19034422 AAGGATGGGAAGAAGTTGGATGG + Intergenic
1006757956 6:36433490-36433512 AATGGTAGGCAGATGGGGAAGGG + Intronic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007258061 6:40542361-40542383 AATGCTGGGCAGGAGGAGGAGGG + Intronic
1008402540 6:51080172-51080194 ACTGATAGGAAGAAAGTAGAAGG + Intergenic
1011996338 6:93593632-93593654 AAAGATAGGCACAAACTGGAGGG + Intergenic
1012230739 6:96758385-96758407 AATCATGGGCAGAAGGCAGAGGG - Intergenic
1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG + Intergenic
1012909615 6:105104298-105104320 AATGTTACACAGAATGTGGAAGG - Intronic
1012954343 6:105552866-105552888 TATGAGAGGCTGAAGATGGAAGG + Intergenic
1013226370 6:108121660-108121682 AGAGATGGGCAGAAGCTGGAAGG - Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1018116544 6:160591381-160591403 CATATTTGGCAGAAGGTGGAAGG - Intronic
1018619417 6:165715549-165715571 AATGAAGGGGAGAAGGAGGAGGG + Intronic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1020957461 7:14759422-14759444 AATGATAGCCAGAGGTTAGAGGG - Intronic
1021385809 7:20028345-20028367 AATCAATGGCAGAAGGTGAAGGG - Intergenic
1022161239 7:27713365-27713387 AATCATGGGCAGAAGGTGAGAGG + Intergenic
1022253208 7:28629321-28629343 AAGGAAAGGGAGGAGGTGGAAGG - Intronic
1023447212 7:40244269-40244291 AAAGATAGATAGAATGTGGATGG + Intronic
1023665457 7:42518303-42518325 AATGAGAGGAAGAAGGTCTAAGG + Intergenic
1027509554 7:79062732-79062754 GATGACAGGGAGGAGGTGGAAGG - Intronic
1028596658 7:92553318-92553340 GAGGATAGGCTGATGGTGGAGGG + Intergenic
1028770157 7:94610182-94610204 AATGATTGCCAGAAGTTGGGGGG + Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1031244845 7:119298375-119298397 AAAAATAGAAAGAAGGTGGAGGG - Intergenic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1034274509 7:149818127-149818149 AAGGACAGGCAGAAGGTGGTGGG + Intergenic
1035348246 7:158222568-158222590 TATGAAAGGCAGAGGGTGGGAGG + Intronic
1035458914 7:159027379-159027401 GATGGGAGGCAGAAGGTGCAGGG - Intergenic
1037416137 8:18651862-18651884 AATTATTGGCAGAACGTGAAGGG + Intronic
1038774622 8:30517456-30517478 AATTAGTGGCTGAAGGTGGAGGG + Intronic
1039301418 8:36213198-36213220 AATGAGATGCCGAAAGTGGAAGG - Intergenic
1040727341 8:50398278-50398300 TATGATGGGCAGATGGTGGACGG - Intronic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1043781792 8:84345625-84345647 AATGAGAGGGAGATGCTGGAGGG - Intronic
1044509875 8:93062536-93062558 AATCATAGGCTGAAAGTGAAAGG + Intergenic
1044667668 8:94647604-94647626 AATGATGGTCAAAGGGTGGAGGG - Intronic
1045014041 8:97983299-97983321 CACAATAGGCAAAAGGTGGAAGG - Intronic
1045439028 8:102191684-102191706 GATAAGAGGCAGAAGTTGGAAGG - Intergenic
1046096947 8:109573817-109573839 AATGATAGGATGAGGGTGGGTGG - Intergenic
1046962219 8:120124181-120124203 AATGTTAGGCGGAAGGTGGGTGG - Intronic
1048254096 8:132892252-132892274 AAGGATAGGCAGATGATGGATGG - Intronic
1048572942 8:135669952-135669974 AATGTGAGGCAGAAGAGGGAGGG - Intergenic
1048631932 8:136252882-136252904 TTTGATTGGCAGAAGGTGAATGG + Intergenic
1051165935 9:14261953-14261975 ATTGCAAGGCAGGAGGTGGAGGG + Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051941443 9:22510146-22510168 AATGGTAGTGAGAAGGTAGAGGG + Intergenic
1052434859 9:28413489-28413511 ACTGAGAGGGAGAAGTTGGAGGG - Intronic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1054472406 9:65548953-65548975 AGTGATAGGAAGAAGGGGCAGGG + Intergenic
1055415748 9:76081068-76081090 AATGATAGGCAAAAGGGGTTGGG + Intronic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058652025 9:107184317-107184339 AATCATGGGCTGAAGGTGAAGGG + Intergenic
1059077548 9:111210122-111210144 AATAACAGGCAGAAGGTTGTGGG + Intergenic
1059208880 9:112492509-112492531 CATGAAAGGCAGTAGGTAGAGGG - Intronic
1059681732 9:116592306-116592328 AATCATGGGCAGAAGATGAAGGG + Intronic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1062520757 9:136956959-136956981 GATGATGGGTAGATGGTGGATGG + Intronic
1062520780 9:136957047-136957069 GATGATGGGTAGATGGTGGATGG + Intronic
1185780589 X:2841362-2841384 AATGATAGATAGATGATGGATGG + Intronic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1186429533 X:9493068-9493090 ACTGATAAGAAGCAGGTGGAGGG - Intronic
1186532850 X:10314687-10314709 AATGAGAGGCAGGAGAGGGAAGG + Intergenic
1186734008 X:12441549-12441571 AATGATAGGCAGCTGGGGCAGGG + Intronic
1186923774 X:14309843-14309865 AATGATAGGCAGCCAATGGAAGG - Intergenic
1187223591 X:17354350-17354372 TAAGATAGGCCGGAGGTGGATGG - Intergenic
1187362413 X:18640976-18640998 ATTGCAAGGCAGAGGGTGGAGGG + Exonic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188642304 X:32521430-32521452 AATGATAGGGTGGAGGAGGATGG - Intronic
1189351560 X:40279517-40279539 TATGATGGGCTGAAAGTGGAGGG + Intergenic
1189526065 X:41823279-41823301 TTCGATAGGCAGCAGGTGGAGGG - Intronic
1189600362 X:42617517-42617539 AATGGCAGGCAGATTGTGGAGGG - Intergenic
1190311857 X:49122564-49122586 AAGAAGAGGAAGAAGGTGGAAGG - Intronic
1191663216 X:63671514-63671536 TGTGAGAGGCAGAAGGTTGAAGG + Intronic
1192040723 X:67618540-67618562 AATGAAAGCCACATGGTGGATGG + Intronic
1192050067 X:67716644-67716666 AATGCCAGGCAGAAAGAGGATGG + Intronic
1193808849 X:86026960-86026982 GATGATAAGCAGGAGGTTGATGG - Intronic
1195237649 X:102917561-102917583 AATGACAGAGAGAAGGTGGGAGG + Intergenic
1195348901 X:103978544-103978566 AATTATAGGAAGAAAGAGGAAGG + Intergenic
1195358542 X:104060295-104060317 AATTATAGGAAGAAAGAGGAAGG - Intergenic
1197113702 X:122806269-122806291 AAAAGTAGGCAGAATGTGGAAGG + Intergenic
1197359493 X:125482466-125482488 AAAGATAGGAAGCATGTGGATGG + Intergenic
1197798969 X:130329009-130329031 ATAGATAGACAGTAGGTGGAGGG + Intergenic
1198572194 X:137969951-137969973 GATGATAGGGAGAAGGAAGAGGG - Intergenic
1199082402 X:143591517-143591539 ACTGAGAGGCATAAGGTAGAAGG + Intergenic
1200132114 X:153855921-153855943 GGTGCTTGGCAGAAGGTGGATGG - Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic
1202019461 Y:20449740-20449762 AGTGAAAGGCTGAAGCTGGATGG - Intergenic