ID: 1080456637

View in Genome Browser
Species Human (GRCh38)
Location 11:32425477-32425499
Sequence TTGTTTAGGAGTAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080456631_1080456637 16 Left 1080456631 11:32425438-32425460 CCATTACATTCACAAAAGCATTT 0: 1
1: 0
2: 8
3: 38
4: 435
Right 1080456637 11:32425477-32425499 TTGTTTAGGAGTAGGAAAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080456637 Original CRISPR TTGTTTAGGAGTAGGAAAGA GGG Intronic
901067268 1:6500272-6500294 TTGTTGGGGAGCAGGAAAAAGGG + Intronic
903671528 1:25038722-25038744 TTAATTAGGAGGAGGAGAGAAGG + Intergenic
903970455 1:27115407-27115429 TTGTTTTGGGGTGGGAAAGTAGG + Intronic
904288916 1:29471295-29471317 TTGGTAGGGAGTATGAAAGAGGG - Intergenic
905096054 1:35471907-35471929 TTGTTTTGGAGGAGGAAGGAAGG - Intronic
905378979 1:37546273-37546295 ATGTTTTGGAGTAGGAAGGGTGG - Intronic
908547187 1:65173574-65173596 TGCTTTGGGAGAAGGAAAGAAGG - Intronic
908684197 1:66696632-66696654 TTGGGTAGTATTAGGAAAGATGG + Intronic
908975233 1:69888766-69888788 CTGTTTGGGGGTAGGGAAGATGG + Intronic
910502467 1:87908717-87908739 CAGTTTAGGAGAAGGAAGGAGGG + Intergenic
911433103 1:97818014-97818036 ATATTAAGGACTAGGAAAGAAGG - Intronic
911747302 1:101453887-101453909 TAGTGTAGAAGTAGGAGAGATGG + Intergenic
912581826 1:110727885-110727907 TGGTTTGGGTGTAGGAAAGATGG + Intergenic
913385250 1:118252083-118252105 TTGTATAAAAGTAGGAAAAAAGG + Intergenic
914982660 1:152428851-152428873 TTATTTAGGAGAGGGAAACAAGG + Intergenic
915303988 1:154967616-154967638 TGGATTAGGATTAGGAAAGGAGG - Intronic
917253717 1:173091286-173091308 TTGAATAGGAGTGGGAGAGAGGG - Intergenic
917662430 1:177190486-177190508 CTGTTTTGGAGAAGGGAAGAAGG - Intronic
917718993 1:177768081-177768103 TTGCTTAGGAGTAAGATAGTGGG - Intergenic
918000099 1:180485635-180485657 TTGTGGAGGTGTTGGAAAGAAGG - Intronic
919421812 1:197379081-197379103 TTGTTTGTGGATAGGAAAGATGG + Intronic
919659431 1:200229408-200229430 GTGTATAGTAGTAAGAAAGATGG - Intergenic
919973715 1:202597426-202597448 TTCTCTAGGAGGAGAAAAGAAGG + Intronic
920193321 1:204209474-204209496 TTGTTCAGGAAGAGGAAGGAGGG + Intronic
920754072 1:208711208-208711230 TTATTTAGTAATAGAAAAGAAGG - Intergenic
921418390 1:214917388-214917410 CTGTGGAGGAGTAAGAAAGAAGG - Intergenic
922440257 1:225650212-225650234 TTGAATAAGAGCAGGAAAGAGGG - Intronic
923819349 1:237419697-237419719 CTGTCTAGCAGTAGGAAAGTAGG + Intronic
923872131 1:238006901-238006923 TTGTTTTGTAGCAGGAAAGATGG + Intergenic
1063466955 10:6252845-6252867 TTTTTTAGAAGTAGGGGAGAGGG + Intergenic
1063467636 10:6257760-6257782 TTGTGAAGGAGTAGGGAAGCTGG + Intergenic
1063718854 10:8558152-8558174 CTGTGTAGGTGTTGGAAAGAGGG - Intergenic
1064340934 10:14484751-14484773 GTGGTTAGGGGTAGGAAATAGGG - Intergenic
1068748113 10:60558550-60558572 TTATTTAGGAGGAGGGAATAGGG - Intronic
1068922864 10:62503300-62503322 TAGCTTAGAAGTAGGAGAGAAGG - Intronic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1071254831 10:83862772-83862794 TTGGTTTGGAGTAGGAAATGGGG - Intergenic
1072173034 10:92885795-92885817 TTGTTTAAAAGTAAAAAAGAGGG - Intronic
1074139413 10:110658804-110658826 TAGTTGAGGAGAGGGAAAGAGGG - Intronic
1074310069 10:112314647-112314669 TTGTGGGGGAGTAGGAGAGAGGG + Intergenic
1074833076 10:117263502-117263524 TTTTTTAGGGGTAGTAAAGATGG + Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1074919887 10:117997203-117997225 TTGTTGAGTAGAAGGAAGGAAGG + Intergenic
1075219328 10:120570940-120570962 CTGTCTGTGAGTAGGAAAGATGG - Intronic
1075770164 10:124927725-124927747 TTGTTTTGAAGTGGTAAAGAAGG + Intergenic
1077350909 11:2092807-2092829 TGGTTGGGGTGTAGGAAAGAGGG - Intergenic
1079417323 11:20251465-20251487 ATGTTTAGTAGTAGGAATGCTGG + Intergenic
1079827125 11:25211419-25211441 TTGTTAGGGAGTAGTAAAGATGG - Intergenic
1080456637 11:32425477-32425499 TTGTTTAGGAGTAGGAAAGAGGG + Intronic
1080673869 11:34406256-34406278 ATATTTAGGAGTAGGAAAAAAGG - Intergenic
1080704089 11:34672250-34672272 TAGTTTGGGATTTGGAAAGAGGG + Intergenic
1081447393 11:43144114-43144136 TTGTAAAGGAGTAGGAAGAAGGG + Intergenic
1082093822 11:48110506-48110528 TTCTTTAGAAGTAGGAGTGAGGG + Intronic
1083026055 11:59551865-59551887 TTGTCAAGGATTAGGAAAAAAGG - Intergenic
1083967208 11:66050166-66050188 TGGTTGAGGAGGAGGAAATAGGG + Intergenic
1085588448 11:77733861-77733883 TTGTTTAGGAATGAAAAAGATGG - Intronic
1085713560 11:78852381-78852403 TTGTTTAGAAGTAAGAACCAGGG + Intronic
1086695434 11:89839064-89839086 TAGTTTATGAGTGGCAAAGAAGG - Intergenic
1086710719 11:90005421-90005443 TAGTTTATGAGTGGCAAAGAAGG + Intergenic
1087762247 11:102112679-102112701 GGGTTAAGGAGGAGGAAAGAAGG + Intronic
1088329598 11:108637029-108637051 TTATTTAGAAGTACAAAAGAAGG + Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088638377 11:111846905-111846927 ATGTTTAGGTGAAGGAAAGCTGG + Intronic
1088693745 11:112349041-112349063 TGGTTCAGGAGTGGGAAAGAAGG + Intergenic
1089179231 11:116569495-116569517 TCGCTTGGGATTAGGAAAGAAGG + Intergenic
1090261078 11:125320685-125320707 TTGTTGAGGTGAAAGAAAGAAGG - Intronic
1091478043 12:796670-796692 TTTTTTAGGGGCAGGAAAAATGG - Intronic
1091635258 12:2192294-2192316 TTGTTTGGGAGCAGCAAAGTGGG - Intronic
1091708033 12:2713268-2713290 TTGTTTAATGGTTGGAAAGAAGG - Intergenic
1092847796 12:12600311-12600333 GGATTTAGGAGTAGGAAAAAGGG + Intergenic
1093366575 12:18307190-18307212 CTATTTAGGAATAGGAAATAAGG + Intronic
1093390235 12:18609949-18609971 TTTTTGAGGAGAAGGAAATATGG - Intronic
1097575217 12:61384337-61384359 TTGTTTAGGTGGAAGACAGAGGG - Intergenic
1098027067 12:66214921-66214943 TTGGATAGGAGTGGGGAAGAAGG + Intronic
1098078984 12:66763356-66763378 TTGTACAGGAGTAGGCTAGATGG - Intronic
1098092515 12:66919245-66919267 TTCTTTAGGGTTGGGAAAGAGGG + Intergenic
1099637482 12:85232406-85232428 TTGATTAGTACTAGTAAAGATGG - Intronic
1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG + Intronic
1099883848 12:88502643-88502665 TTGTTTAGGAGGAAAAAAGATGG - Intronic
1100347483 12:93746791-93746813 TTTTTTTGAAGAAGGAAAGAAGG + Intronic
1101007042 12:100411151-100411173 TTGTTTAGGAGTAAAAAAATAGG + Intronic
1101136314 12:101747378-101747400 TTGTTTTGGAAGAGGAATGATGG - Intronic
1102400032 12:112620817-112620839 TGGATGTGGAGTAGGAAAGAAGG - Intronic
1106271747 13:28160983-28161005 TAGTTTAGTACTAGGAAAAATGG + Intronic
1107936311 13:45348154-45348176 TTATTTGGGAGTAGTGAAGAGGG + Intergenic
1108887500 13:55205907-55205929 TTTTTTAGGTGTGGGAACGAAGG - Intergenic
1110660453 13:78054688-78054710 TTGCTTAGGAGTAGGCAAGGTGG - Intergenic
1111331450 13:86764656-86764678 TTGTTGGGGAGGAGGAAAGCGGG + Intergenic
1111542161 13:89683017-89683039 TTATTTACTAGTATGAAAGATGG + Intergenic
1112956564 13:105066323-105066345 TTGTTTTGGAGAAGAAAAGGGGG - Intergenic
1114151419 14:20044131-20044153 TTTCTTAGGAGTAGCAAAGGAGG - Intergenic
1114192465 14:20450466-20450488 TTGCTTAGGTGTAAGAAACAGGG - Intronic
1115431209 14:33320840-33320862 TTGTTTAGTGGTGGGATAGATGG + Intronic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1115953525 14:38748974-38748996 CTGTTTTGGAGTGGGGAAGAGGG - Intergenic
1116571655 14:46525143-46525165 TTGTTTACAAGTAGTAAAGATGG - Intergenic
1116801404 14:49448072-49448094 TTGATTAGGAGTAGCAAAGTAGG + Intergenic
1117946935 14:61037166-61037188 TTGTTTAGAAAAAGGAAAGAAGG + Intronic
1119242693 14:73074608-73074630 TTGTTTAGAATCAGAAAAGATGG + Intronic
1119286461 14:73458588-73458610 TAGGTTAGAAGTATGAAAGAGGG - Intronic
1119286631 14:73460023-73460045 TTATTTAGGAGCAGGAAAAGTGG - Intronic
1120267498 14:82269834-82269856 TTGTTTAGGAGAAGAGATGAAGG + Intergenic
1120408931 14:84126112-84126134 CTGCATAAGAGTAGGAAAGAGGG + Intergenic
1120434680 14:84466342-84466364 TTCTTTAAGATGAGGAAAGAGGG + Intergenic
1121068905 14:90998187-90998209 TTGTTTAGGACTGGGGAGGATGG + Intronic
1123801921 15:23830502-23830524 TTGCTTAGGGCTAGGAAGGATGG - Intergenic
1125220614 15:37329260-37329282 TTGTTTAGTATTAGAAAAAATGG + Intergenic
1127899637 15:63331410-63331432 TTGTTTCTGAATAGGAAAGAAGG + Intronic
1128153978 15:65380563-65380585 TTTTTTGGGTGCAGGAAAGAGGG - Intergenic
1128247031 15:66140142-66140164 TTGTTCAGGAGTGGGTATGAAGG - Intronic
1128907527 15:71481068-71481090 TTGTTTTGGGGTAGGGAAAAAGG + Intronic
1129164962 15:73771694-73771716 TTGTTTCTGAGGAGGAAACAAGG - Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130124433 15:81081147-81081169 TTTTTTAGGAGTAGAGCAGATGG + Intronic
1130239170 15:82169453-82169475 TTTTTTAGGAGCTGGGAAGAAGG + Intronic
1130623604 15:85490158-85490180 TTGTTTAGAGAGAGGAAAGATGG + Intronic
1131401946 15:92132108-92132130 TTGTTTAGCAGTTGGCAAGTGGG + Intronic
1131450178 15:92532859-92532881 TGGTTTAGGGGTAGGCAACAGGG - Intergenic
1132037850 15:98501551-98501573 TTATTTTGGAATTGGAAAGATGG - Intronic
1137780337 16:51092777-51092799 TTGGTGGGGAGTTGGAAAGAGGG + Intergenic
1139364374 16:66424791-66424813 TTGTTTAGAAGTATGAAAAATGG + Intergenic
1139444609 16:66989129-66989151 CTGCTTAGGAGAAGGAAAGAAGG - Intronic
1140304217 16:73787581-73787603 TTGTTTAGTCCTAGGAATGAAGG + Intergenic
1141105573 16:81230667-81230689 CTGTGGAGGATTAGGAAAGAAGG - Intergenic
1141353836 16:83324409-83324431 TTGTTTAGAGATAGGAAAGAGGG - Intronic
1141863280 16:86732736-86732758 TTGCTTTGCTGTAGGAAAGACGG + Intergenic
1145722700 17:27088542-27088564 GTGATGAGGAGGAGGAAAGAGGG - Intergenic
1146072578 17:29697503-29697525 TTCTGTATGAGAAGGAAAGAGGG - Intronic
1146861341 17:36302259-36302281 TTGTTCAGCATTAGGAAATATGG + Intronic
1147091673 17:38106363-38106385 TTGTTCAGCATTAGGAAATATGG + Intergenic
1147105539 17:38214142-38214164 TTGTTCAGCATTAGGAAATATGG - Intergenic
1147673557 17:42190510-42190532 TTTTGTAGGAGTAGTAAAGGAGG + Intronic
1148423963 17:47574359-47574381 TTGTTCAGCATTAGGAAATATGG + Intronic
1150965552 17:69963937-69963959 TTGTTAAAGAGTAAGGAAGATGG - Intergenic
1155583421 18:27338335-27338357 ATTTTTAGTAGTAGTAAAGATGG - Intergenic
1155712132 18:28895271-28895293 TTGAGTAGGAGTAGGAAAGGTGG - Intergenic
1155716844 18:28954235-28954257 TTGAATAGGAGTGGCAAAGAGGG - Intergenic
1156249205 18:35335109-35335131 TTGTATCAGAGTAGGTAAGAAGG - Exonic
1156483571 18:37450877-37450899 TTTTTCAGGAGTGGGAAGGAGGG + Intronic
1158823132 18:61184249-61184271 TTCTATGGGAGTAGCAAAGATGG - Intergenic
1159279323 18:66265013-66265035 TGGTTTAGGAGAAGGGAAAAGGG - Intergenic
1159425789 18:68284408-68284430 TTGTTTATGTGAAGGAAATAGGG + Intergenic
1159753575 18:72334532-72334554 GTGTTTGAGAGTAGAAAAGATGG - Intergenic
1159910260 18:74138902-74138924 TTCTCTAGAAGTAGGGAAGACGG - Intronic
1162075432 19:8183681-8183703 TTGTCAAGGAGAAGGAAGGAAGG + Intronic
1162286980 19:9746129-9746151 TGGATTAGGAACAGGAAAGAGGG - Intergenic
1165992480 19:39824565-39824587 GTGTTTAGGAGAGGGAGAGAAGG - Intergenic
1166589216 19:43981778-43981800 TGGTTTAGGGGTAGGAAGGAGGG + Intronic
925683485 2:6447682-6447704 TTCGTTTGGAGGAGGAAAGATGG + Intergenic
926881026 2:17543408-17543430 TGGTTTTGGAGGAGGACAGATGG - Intronic
926976743 2:18523388-18523410 CTCTTTAGGAGGAGAAAAGATGG + Intergenic
927163434 2:20292323-20292345 TTGTTTGGGAGTAGGAGGAATGG + Intronic
927316581 2:21690216-21690238 TAGTCTAGGAATAGGTAAGAGGG + Intergenic
928147081 2:28788545-28788567 TTGTTTAGTAAAAGGTAAGAGGG + Intronic
929266293 2:39922204-39922226 ATGTGAAGAAGTAGGAAAGATGG - Intergenic
932551559 2:72775144-72775166 TTGTTTAGGAGTTGTTAAGAAGG + Intronic
932837167 2:75048678-75048700 TTGTTTACAAGTAGGAAAAGAGG + Exonic
933350745 2:81149431-81149453 TAGTTGAGAGGTAGGAAAGACGG - Intergenic
933908852 2:86920368-86920390 TTGTTTAAAATTAGAAAAGAAGG - Intronic
934023872 2:87983017-87983039 TTGTTTAAAATTAGAAAAGAAGG + Intergenic
934731634 2:96662153-96662175 TTTTTCAGGAGGAGGAAATAGGG - Intergenic
934739285 2:96707522-96707544 TTGTTTCTCAGTTGGAAAGAGGG - Intronic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
935409976 2:102751414-102751436 TTGGAAAGGAGAAGGAAAGATGG + Intronic
935535733 2:104291811-104291833 TTTTTTAAGAGTAGAAAAGTAGG + Intergenic
936653720 2:114459823-114459845 TTCTTGAGTAGTAGTAAAGAGGG + Intronic
938057770 2:128229967-128229989 TTCTTTAGGAGTAGGTCAGCTGG + Intergenic
940680541 2:156779792-156779814 CTGTTTAGTAGTAGGAAGTAGGG + Intergenic
940708258 2:157130724-157130746 TTGAATAGGAGTGGTAAAGAGGG - Intergenic
942167017 2:173251649-173251671 TTGTTTGGGAATAGGCACGAGGG + Intronic
942804723 2:179916917-179916939 TTGCTTTGGAGTAGAGAAGAAGG + Intergenic
943401465 2:187416444-187416466 TTATTTAGGTGTAAGAAACAGGG - Intronic
943445875 2:187987348-187987370 CTGTTAAGGAGGAGAAAAGAGGG + Intergenic
943544203 2:189254517-189254539 AAGTCTAGGAGTGGGAAAGAGGG + Intergenic
944849163 2:203699994-203700016 TTGAATAGGAGTGTGAAAGAGGG - Intergenic
944897215 2:204177529-204177551 CTTTTTAGGAGTAGGGAAGGAGG - Intergenic
946820653 2:223625965-223625987 TAGTTGAGGAGAAGGAAATAAGG + Intergenic
947653051 2:231803388-231803410 GTGTTGAGGAGTGGGAAGGAAGG + Intronic
947692010 2:232147348-232147370 TAGTTTTGGAGGAGGAGAGAAGG - Intronic
948137360 2:235646665-235646687 TTGTTCAGGGGTTAGAAAGATGG - Intronic
1169658574 20:7953574-7953596 TTAAATAGGAGTGGGAAAGAGGG + Intergenic
1179224711 21:39443459-39443481 TTGGTTAGGAGGAGGAAGGAAGG + Intronic
1179453479 21:41481451-41481473 TTGCTTATGAGTAGGAGGGACGG + Intronic
1182147843 22:28007884-28007906 CTGATTAGGAGGAGGAAAAATGG - Intronic
1182803672 22:33052461-33052483 CTGTTTGGGAGGAGGAAAGGAGG + Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1185164011 22:49247212-49247234 TTGCTGGGGAATAGGAAAGATGG + Intergenic
949372004 3:3345315-3345337 TTATTTAGGAGGAGGAAAGCTGG - Intergenic
949416816 3:3823940-3823962 TCATTTAGAGGTAGGAAAGATGG + Intronic
950169423 3:10827687-10827709 TTATTTAGGGGAAGTAAAGATGG + Intronic
950213825 3:11143438-11143460 TTGCTCAGGAGTTGGATAGATGG - Intronic
952348376 3:32510023-32510045 TTTGGAAGGAGTAGGAAAGAAGG + Intergenic
953621977 3:44541414-44541436 TTGTTTAGGATTAGAAAAGACGG - Intergenic
954619164 3:51985955-51985977 TTGTGGAGGAGTAGGAATGGAGG - Intronic
954797744 3:53170077-53170099 GTGTTTGGGAGAAGGCAAGATGG - Intronic
957150285 3:76477787-76477809 TTTTTTAGTAGTAGGACATAAGG - Intronic
958488427 3:94741957-94741979 TATTTTAGGAGTAGCAAGGAGGG + Intergenic
958778294 3:98511400-98511422 TTGGTTAGAACTAGGAAGGAAGG - Intronic
958998640 3:100936015-100936037 TTGAATAGGAGTGGGAGAGAGGG + Intronic
960833001 3:121870361-121870383 TTATTTAGGAGTATGGATGAGGG + Intronic
964411726 3:156404805-156404827 TTTTTTGGGAGTAGGAAGGAAGG + Intronic
965698564 3:171436151-171436173 CTGTATAGGAGTGGGGAAGATGG - Intronic
967108714 3:186273986-186274008 GTGATAAGGAGTAGGAAAGAAGG - Intronic
970236514 4:13964232-13964254 TTTTTTTGGAGTAGAAAAGGAGG + Intergenic
972650392 4:41012037-41012059 TTTTTTTGGAGGAGGAGAGATGG + Intronic
973087792 4:46089660-46089682 TTGTTAAGAAGTAGGAAAATAGG + Intronic
973249410 4:48046130-48046152 TTGTCCAGGTGTAGGGAAGAAGG - Intergenic
973551533 4:52040088-52040110 CTCTTTAGGAGTTGAAAAGATGG - Intergenic
973794026 4:54405684-54405706 TTGTTTAGGAATAGGAGAGCTGG - Intergenic
974492022 4:62577253-62577275 TGGTTTAGCATTAGGACAGAAGG - Intergenic
974570306 4:63637771-63637793 TGATTTAGGAGTAAGGAAGAAGG - Intergenic
974804158 4:66858524-66858546 TTGTTAAGGAGTAGTTAAGAAGG - Intergenic
974885723 4:67814635-67814657 TTGTTTAGGTGTAAGGAAGGGGG - Intergenic
975627638 4:76365513-76365535 AGGTTTAGGGGTAGGAAGGAGGG - Intronic
977687181 4:99860270-99860292 TTGTTTGGGTGGAGGTAAGATGG + Intronic
978246408 4:106577055-106577077 TTGTATAGGAGGAGCCAAGATGG - Intergenic
978887469 4:113782294-113782316 TTTTTTAGGGGGAGGAATGAGGG - Intergenic
979222174 4:118240178-118240200 TTGCTTATGAGCTGGAAAGAGGG + Intronic
980186330 4:129465509-129465531 TTGGTTAGGAGAGGGGAAGAGGG + Intergenic
980187507 4:129480621-129480643 GTGTTTAGGTATAAGAAAGAGGG - Intergenic
981130226 4:141150327-141150349 TTGGATATGAGTATGAAAGAAGG - Intronic
981813624 4:148803760-148803782 TTGTTTGTTAGTAGGAAAGGGGG + Intergenic
981905048 4:149912948-149912970 TTGATTAGTTGCAGGAAAGAGGG + Intergenic
981990098 4:150908142-150908164 TTGTTTATCAGTAGGAAATATGG - Intronic
982235291 4:153246640-153246662 TGGATAGGGAGTAGGAAAGAGGG + Intronic
982762759 4:159306670-159306692 TTGAATAGGAGTGGGAAAGTGGG + Intronic
983460281 4:168018107-168018129 TTGTTTCAGAGTAAGTAAGAGGG - Intergenic
984063382 4:175019736-175019758 TTGTTGAGGAGGAGCCAAGATGG + Intergenic
984360070 4:178718231-178718253 ATTTTTAGGAGTATGAAAGTGGG + Intergenic
985315395 4:188653822-188653844 TTGTTTAGTAATGGTAAAGATGG + Intergenic
986963892 5:13246969-13246991 TTTTTGAGGGGGAGGAAAGATGG + Intergenic
987384679 5:17318049-17318071 TAGTTTGGGAGGAGAAAAGATGG + Intergenic
989704454 5:44311902-44311924 CTGTGAAGGAATAGGAAAGAAGG - Intronic
989763429 5:45049095-45049117 ATGTTCACGAGTAGGAAAAAGGG - Intergenic
990237273 5:53781693-53781715 ATGATTAGGAGAAGGTAAGAAGG + Intergenic
991676342 5:69093084-69093106 TCCCTTAGGAGTAGGAGAGAAGG + Intergenic
992215411 5:74520170-74520192 TTGCTTAGAGGTAGGGAAGATGG + Intergenic
993315400 5:86398441-86398463 TTGTTTAAAAGCAGGAAAAAAGG + Intergenic
994007150 5:94851855-94851877 ATGTTTAGAAGTAGGAGTGAAGG + Intronic
995785270 5:115821000-115821022 TTGTTCAGGAGGAGGAGAAATGG - Intergenic
995832252 5:116366148-116366170 TTGCTTAAGACTAGGATAGATGG + Intronic
996539906 5:124619487-124619509 TTTGTTAGGAGTAGGAAATAGGG - Intergenic
997157614 5:131576179-131576201 TGGATTAGGAACAGGAAAGAGGG - Intronic
997361041 5:133295087-133295109 TTGTGTAGGAGAGTGAAAGAGGG - Intronic
997848659 5:137311301-137311323 TTGTTGAGGGGTGGGAAGGAGGG + Intronic
998193506 5:140046313-140046335 TTTTTTGGTAGTAGTAAAGATGG - Intergenic
999818203 5:155198905-155198927 TTTTTTAGGAGTGGGAAACCTGG - Intergenic
1000230113 5:159307922-159307944 TTGCTTAGGAGAAGGAAACAGGG + Intergenic
1000540392 5:162531662-162531684 TGGTTTAGGAGGAGCCAAGATGG - Intergenic
1004015939 6:11732007-11732029 GTGTTTTGGGGTAGGAGAGAAGG + Intronic
1005163208 6:22889686-22889708 TTCTTTAGAAGTAGGAAATCTGG + Intergenic
1008474994 6:51927143-51927165 TTATTTAGGACTGGGAAGGAAGG - Intronic
1009550368 6:65084878-65084900 TTGTGGAGGAATAAGAAAGAGGG + Intronic
1009809397 6:68640627-68640649 TGGTTGAGGAAAAGGAAAGAGGG - Intronic
1010254020 6:73737754-73737776 TTGTGTGGGAGTAGGGAAAATGG + Intronic
1010731741 6:79398447-79398469 TAATTTAGGAGTATGAAAGTTGG + Intergenic
1012165626 6:95947275-95947297 TTGTTTAGGGATGGGAAAGTGGG + Intergenic
1012227497 6:96721282-96721304 TTTCTTTGGAGTAGAAAAGAGGG - Intergenic
1012754519 6:103208549-103208571 TTGATTAGAAGTAGGAAAAATGG + Intergenic
1012958947 6:105601984-105602006 TTATTTAGGCTGAGGAAAGAAGG - Intergenic
1013569164 6:111403217-111403239 TTGCTCAGGAGTGGGAAACATGG + Intronic
1013865763 6:114694501-114694523 TTGTTTAAGACAAGGAAAGAAGG + Intergenic
1013887599 6:114988900-114988922 GTCATTAGGAGTAGGAAAGGGGG - Intergenic
1014276844 6:119398057-119398079 TTGTTTCTGGCTAGGAAAGATGG + Intergenic
1015821241 6:137262952-137262974 TTGTTTAGCCCTAAGAAAGAAGG + Intergenic
1016633662 6:146261306-146261328 TTGTAAATGAGTAGGAAAGGAGG + Intronic
1018745113 6:166755648-166755670 TTGTTTAGGTGAAGGAAAGGAGG - Intronic
1020671303 7:11116672-11116694 TTGTTCAGGAAGAGGAGAGAAGG + Intronic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021153594 7:17181779-17181801 TTGTTTAGGAACAGCAAAGAGGG - Intergenic
1022315563 7:29241735-29241757 TTGTCCAGGAGGAGGAAAGACGG + Intronic
1022539129 7:31120093-31120115 TTGTTTTGGAGAAGGAAAGAAGG - Intergenic
1022615112 7:31921289-31921311 TTGTTTGGGAGTGAGAGAGATGG + Intronic
1023732492 7:43205761-43205783 TTGGGTAGGGGTAGGACAGAAGG - Intronic
1024740185 7:52345028-52345050 TTGATTATGAGGAGGAAAGCTGG - Intergenic
1026510979 7:71027224-71027246 ATGCTTAGCAGAAGGAAAGAAGG - Intergenic
1028154597 7:87415372-87415394 TTGCTTAAGAGTCGGAAAGAAGG - Intronic
1028419420 7:90615580-90615602 TTTTTTTTGAGTGGGAAAGAAGG + Intronic
1028682857 7:93557725-93557747 TTGTTTCTGAGTATGATAGAAGG + Intronic
1030248000 7:107406940-107406962 TTGTTTAGTTGTGAGAAAGATGG - Intronic
1030600396 7:111585097-111585119 TTTTTTAGTTGTAAGAAAGAGGG + Intergenic
1030921136 7:115389602-115389624 ATATTTAAGAGTAGGAAAGAAGG - Intergenic
1031069758 7:117149315-117149337 GTGTTTAGGGGTAGGAAGGTCGG - Intronic
1032347991 7:131134621-131134643 AGGTTTGGGAGTAGGAGAGACGG - Intronic
1034180168 7:149130911-149130933 TTGGTTAGGGGTAAGGAAGAGGG + Intronic
1035173604 7:157034384-157034406 TTGTCTAGTAGTTGGAAAGACGG - Intergenic
1036774473 8:11600754-11600776 ATGTATAGAAGTAGGAATGAGGG + Intergenic
1038952753 8:32433727-32433749 TTTTATACCAGTAGGAAAGAGGG - Intronic
1042784459 8:72532771-72532793 TTATTTAGAAGAAGAAAAGAAGG + Intergenic
1043398190 8:79858485-79858507 TTGGGGAGGAGAAGGAAAGAGGG - Intergenic
1043459488 8:80445409-80445431 TCATTTAGGAATAGGAAGGAAGG - Intergenic
1045141040 8:99283070-99283092 TTGTTTAGGAGTTTTAAAAATGG + Intronic
1045158607 8:99509734-99509756 TTTTTCAGGTGTTGGAAAGAGGG + Intronic
1046592763 8:116225631-116225653 TTGTTTGGGAGCAGCTAAGAAGG - Intergenic
1047086530 8:121523146-121523168 ATGTTAAGGAATAGAAAAGAGGG + Intergenic
1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG + Intergenic
1049982698 9:919509-919531 TTTTTCAGGATAAGGAAAGAAGG - Intronic
1050467051 9:5938018-5938040 TTGTTTGGGAGTAGGGTAGAAGG - Intronic
1050772567 9:9220915-9220937 TGGTGTATGAGTAGGAAAGTAGG + Intronic
1051048593 9:12905083-12905105 ATGTTCAAGAGTAGGAAAGGTGG - Intergenic
1053606844 9:39668545-39668567 AGGTTTAGGGGTAGGAAAGACGG + Intergenic
1053864761 9:42425175-42425197 AGGTTTAGGGGTAGGAAAGATGG + Intergenic
1054246692 9:62673857-62673879 AGGTTTAGGGGTAGGAAAGACGG - Intergenic
1054560813 9:66708391-66708413 AGGTTTAGGGGTAGGAAAGACGG - Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1055246204 9:74246647-74246669 TTGTTCAAGTGTAGAAAAGAGGG + Intergenic
1059679529 9:116572494-116572516 ATGTTTTGGAGAATGAAAGAGGG + Intronic
1061642839 9:131973205-131973227 TTGTTCATAAGGAGGAAAGAGGG - Intronic
1061648797 9:132029106-132029128 TTTGATAGGAGTTGGAAAGAAGG - Intronic
1061689621 9:132315597-132315619 TTGATTGGGAGCAGGAAAAAGGG - Intronic
1187018154 X:15351059-15351081 TTTTTTAGTAGTAGTAGAGATGG + Intronic
1187967033 X:24621986-24622008 TGGCCTAGAAGTAGGAAAGAAGG + Intronic
1187992636 X:24892019-24892041 TTGACTTGGAGTAGGAAAGCTGG + Intronic
1188047402 X:25442266-25442288 TTGTTTTGGAGCAGAAAGGAAGG + Intergenic
1188872517 X:35390428-35390450 CTGTTTAGGTATAGGAAAGAAGG + Intergenic
1188916730 X:35920230-35920252 TTGTTTAGGATTAGGAGATGGGG + Intronic
1188929260 X:36086357-36086379 TTGTATAGGAGCATGGAAGAGGG - Intronic
1189710403 X:43805429-43805451 TTGTCTAGGAAGGGGAAAGAGGG - Intronic
1192048029 X:67696982-67697004 TTGGTTTGGAGGAGGAAGGAAGG + Intronic
1192764213 X:74125879-74125901 TGGATTAGGAACAGGAAAGAGGG + Intergenic
1193863758 X:86703374-86703396 TTGTATAGGAGTGGTAAAAATGG - Intronic
1194223460 X:91225834-91225856 TAATTTAGGAGTATGAAATATGG + Intergenic
1198303578 X:135355830-135355852 TTGCTTTGGAGTGGGAGAGATGG - Intronic
1198766677 X:140087387-140087409 ATGTTTAGGAATAGGAAAAGAGG + Intergenic
1199077604 X:143542316-143542338 TTGAATAGGAGTAGGAAAATGGG - Intergenic
1199428519 X:147731809-147731831 CTGTTTTTGAGTAGGCAAGAAGG + Intergenic
1200559927 Y:4689217-4689239 TAATTTAGGAGTATGAAATATGG + Intergenic