ID: 1080457468

View in Genome Browser
Species Human (GRCh38)
Location 11:32429718-32429740
Sequence TGGCCCTGCCAGGATCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080457468_1080457479 19 Left 1080457468 11:32429718-32429740 CCTATGGGATCCTGGCAGGGCCA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1080457479 11:32429760-32429782 TCCTGGCCCAGGACTGCCCTGGG 0: 1
1: 0
2: 2
3: 50
4: 366
1080457468_1080457475 8 Left 1080457468 11:32429718-32429740 CCTATGGGATCCTGGCAGGGCCA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1080457475 11:32429749-32429771 GCCTCAGATCCTCCTGGCCCAGG 0: 1
1: 7
2: 1
3: 35
4: 328
1080457468_1080457478 18 Left 1080457468 11:32429718-32429740 CCTATGGGATCCTGGCAGGGCCA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1080457478 11:32429759-32429781 CTCCTGGCCCAGGACTGCCCTGG 0: 1
1: 0
2: 6
3: 46
4: 463
1080457468_1080457474 2 Left 1080457468 11:32429718-32429740 CCTATGGGATCCTGGCAGGGCCA 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1080457474 11:32429743-32429765 CCAGCAGCCTCAGATCCTCCTGG 0: 1
1: 0
2: 3
3: 66
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080457468 Original CRISPR TGGCCCTGCCAGGATCCCAT AGG (reversed) Intronic
900460924 1:2801829-2801851 TGCCCCAGCCAGGCTCCAATGGG + Intergenic
900506406 1:3031731-3031753 TGGCCATTCCTGGCTCCCATAGG + Intergenic
901462155 1:9398290-9398312 AGCCTCTGCCAGGATCCCAGTGG + Intergenic
902096626 1:13951003-13951025 TGACCCTGCCTGGAGTCCATGGG + Intergenic
902618250 1:17635496-17635518 TGGCCCATCCAGGAGCCCAGAGG - Intronic
903125461 1:21244531-21244553 TGCCCCTGCCAGGAGCCCTGAGG - Intronic
903340852 1:22653323-22653345 TGGCCCTGCCAGCCTCCCCCAGG - Intronic
904473310 1:30748866-30748888 TGGCCAGGCCAGGATCCCACAGG - Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906058671 1:42934650-42934672 ATGCCCTGACAGGATCCCACAGG + Intronic
906670047 1:47647736-47647758 GGTCCCTGCCAAGACCCCATTGG + Intergenic
908037301 1:60069768-60069790 TGGCCCTGCCAAGATTCCTGTGG + Intronic
912420107 1:109536907-109536929 GGGCCCTGCCATGATACCAAGGG + Intergenic
916022109 1:160801997-160802019 TGGGCCTGGCAGGGTCCCATCGG - Intronic
916184005 1:162113349-162113371 TGGGGCTGCCAGGACCCCACTGG - Intronic
920172831 1:204082320-204082342 AGGCCCTGCCTGGTTCCCATGGG - Intronic
920675048 1:208032742-208032764 TGGCCCTGCCAGTAATCCAAGGG - Intronic
922729662 1:227942966-227942988 CGGCCCTGCCAGGGACCCACAGG + Intronic
922774759 1:228209518-228209540 TGGCCCTGCCAGGGTCACAGTGG - Intronic
923626281 1:235616399-235616421 GGGCCCTGCCAGGAGCCTGTGGG + Intronic
1065774691 10:29108566-29108588 TGGCCCTGCCTAGATGCCAGGGG + Intergenic
1065871240 10:29958028-29958050 GGCCCCTGCCAGGCTGCCATGGG - Intergenic
1067070086 10:43124839-43124861 TGGCCCTGCTTGGATCATATTGG + Intronic
1070802982 10:79254455-79254477 TGGCCCAGGCAGGGTCCCATGGG + Intronic
1071489530 10:86126913-86126935 TATCCCTGCCTGGATGCCATAGG + Intronic
1072033191 10:91540682-91540704 TGACCTTGCCATGACCCCATCGG + Intergenic
1073256032 10:102151951-102151973 TGGCCGTGCCAGTACGCCATGGG + Intergenic
1077103515 11:832444-832466 TGGGCCCCCCAGGACCCCATGGG + Intergenic
1077311058 11:1889325-1889347 GGGCCCTGCCAGGCGCCCTTGGG + Exonic
1077433025 11:2525471-2525493 AGGCCCTGCCAGGCTCCCTCTGG - Intronic
1080457468 11:32429718-32429740 TGGCCCTGCCAGGATCCCATAGG - Intronic
1084649753 11:70482241-70482263 TGGCACTGCCAAGCTCCCAGAGG - Intronic
1085283424 11:75345290-75345312 TGACCCTGCCAGGGCCCCTTAGG + Intronic
1086342153 11:85857588-85857610 AGGCACTTTCAGGATCCCATTGG - Intronic
1089697270 11:120223840-120223862 TGTCCCTGGCAGGATCCCCCAGG - Intronic
1089816862 11:121183511-121183533 TGGCCCTGCCAGGGTCAGCTTGG - Intronic
1090388187 11:126368745-126368767 TGGCTCTGCCAGCTTCCCCTGGG + Intronic
1090390928 11:126386724-126386746 TGGCTCTGCCAGCTTCCCCTGGG + Intronic
1090410286 11:126503392-126503414 CGTCCCTGCCTGGATCCCCTAGG - Intronic
1090964311 11:131584896-131584918 TGGTGCTGCCAGGATCCGCTTGG + Intronic
1093909125 12:24725924-24725946 TGGCCTTGCAAGGATTCCCTTGG + Intergenic
1096527279 12:52218112-52218134 AGGGCCTGACAGGATGCCATAGG - Intergenic
1102416369 12:112766479-112766501 TCCCCCTGCCAGTCTCCCATGGG - Intronic
1103742083 12:123097729-123097751 TGGCCTTGCCATTATCCCAGCGG - Intronic
1104841931 12:131829627-131829649 GGGCCCTGCCAGGACCCCACTGG - Intronic
1112302050 13:98239679-98239701 TGGCCCAGCCAGAAACCCAAGGG - Intronic
1113920533 13:113906077-113906099 TTGTCCTGCCATGTTCCCATGGG - Intergenic
1119071842 14:71593771-71593793 TGCCACTGCCAAGAGCCCATGGG - Intronic
1121709512 14:96027201-96027223 TCGCCCTGCAAGGTTCCCAAGGG + Intergenic
1121994723 14:98593181-98593203 TGGCACTGCAGGGACCCCATGGG - Intergenic
1122744214 14:103888498-103888520 TGTCCCTGCCAGGAGACCACTGG - Intergenic
1122864244 14:104596377-104596399 TGCCCCTGCTAAGATCCCAGAGG + Intronic
1123458622 15:20447393-20447415 TGGATCTCCCAGGATCCCCTGGG + Intergenic
1124264913 15:28223563-28223585 TGGATCTCCCAGGATCCCCTGGG + Intronic
1124313305 15:28647511-28647533 TGGATCTCCCAGGATCCCCTGGG - Intergenic
1124650971 15:31473757-31473779 TGGCCTTAACAGGATTCCATGGG + Intergenic
1125419687 15:39492140-39492162 TGGCCCTTCCAGGATGCACTTGG - Intergenic
1125828112 15:42692848-42692870 TAGCCCTTCAAGGATCACATTGG - Exonic
1128544348 15:68557119-68557141 TGCCTCTGCCAGGAGGCCATGGG + Intergenic
1128732309 15:70029534-70029556 TGACTCTGCCAGGATACCCTTGG - Intergenic
1129359041 15:75012944-75012966 TTCCCCTGCCAGGCTCCCAGAGG + Intronic
1130331222 15:82923753-82923775 AGGCCCTGCCAGGAGCCGAGAGG - Intronic
1131435224 15:92416681-92416703 TCTCCCTGCCAGGGTCCCGTCGG + Intronic
1131853045 15:96563298-96563320 TGGCTCTGCCACCATCACATTGG - Intergenic
1133971078 16:10568598-10568620 TGGCCCTGCCAGGGTGTCACAGG + Intronic
1134395593 16:13860031-13860053 TGGCCCTGCCAGCCTGCCCTTGG + Intergenic
1136703059 16:32160679-32160701 TGGATCTCCCAGGATCCCCTGGG + Intergenic
1136764640 16:32766917-32766939 TGGATCTCCCAGGATCCCCTGGG - Intergenic
1136803459 16:33103467-33103489 TGGATCTCCCAGGATCCCCTGGG + Intergenic
1139651775 16:68365811-68365833 TGACCCTGGCAGGATCCCAAAGG + Intronic
1140032251 16:71348269-71348291 TGGCCCCAGCCGGATCCCATGGG + Intergenic
1142140821 16:88471988-88472010 TGGCCCTGCCGGGCTCCTACCGG - Intronic
1142185602 16:88693435-88693457 TGACCCTCCCAGGATCCTCTGGG - Intergenic
1142418055 16:89953882-89953904 AGGCCCAGAGAGGATCCCATAGG + Intronic
1203066997 16_KI270728v1_random:1029042-1029064 TGGATCTCCCAGGATCCCCTGGG - Intergenic
1142673205 17:1497004-1497026 TGGCCCTGTCGGAATCCCATGGG + Intronic
1143842101 17:9740736-9740758 TGGCCCTTCCAGCACCCAATTGG - Intergenic
1147402394 17:40188854-40188876 TGTCCATGCCAGGATTCCAGAGG + Exonic
1147403604 17:40195307-40195329 TTGCCCTGACAGTGTCCCATGGG + Exonic
1148152376 17:45404410-45404432 TGGTCCTGCCAGGACCTCAATGG + Intronic
1150036075 17:61799867-61799889 TAGTCCTGCCAGCATCACATGGG - Intronic
1152597741 17:81246165-81246187 TGGCCCTGCCACGAGCCAGTTGG + Exonic
1158705292 18:59787094-59787116 TGGCCTGGCAAGGATCACATGGG - Intergenic
1160757296 19:764421-764443 TGGGGCTGTCAGGTTCCCATGGG + Intergenic
1160948561 19:1654770-1654792 TGGCCCAGCCCTGACCCCATGGG + Intergenic
1165266582 19:34666797-34666819 AGGCCCTGCCAGGAGACCCTGGG + Intronic
1167593971 19:50417945-50417967 TGACCTTGCAAGCATCCCATGGG + Exonic
1167994223 19:53389867-53389889 TGGCCCTGCAAGCTTCACATGGG + Intronic
1168002821 19:53463162-53463184 TGGGCCTGCGAGCTTCCCATGGG + Intergenic
925103618 2:1270202-1270224 TGTCCCTCCCAGGACACCATGGG - Intronic
926121413 2:10243161-10243183 TGGCCCTGCCAGGTGCCCTGCGG + Intergenic
929998870 2:46847567-46847589 AGGCCCAGCCAGGATCTCTTAGG + Intronic
931811808 2:65861665-65861687 TGGCCTTCCCAGGATCCCTCTGG + Intergenic
932981101 2:76667972-76667994 TGGCTCTGCCAGGAACCCCGTGG - Intergenic
934950491 2:98572245-98572267 AGGCCCTTCCAGGACCCCTTGGG - Intronic
935762930 2:106338142-106338164 TGGCTCTGCCTGGATCCAGTGGG - Intergenic
935959716 2:108413035-108413057 TGGCCCTGTGAGCATCCCTTTGG + Intergenic
936815485 2:116455925-116455947 TGCCCATGCCAAGCTCCCATGGG + Intergenic
942251035 2:174047918-174047940 CCGCTCTGCCAGGATCCCAGTGG - Intergenic
943819221 2:192298815-192298837 TGGCTTTGCCAAGATTCCATAGG + Intergenic
948131937 2:235607488-235607510 CGGCCTTGCCAGGAGCCCGTTGG + Intronic
1171152990 20:22844296-22844318 TGACCCTGCCAGCACCCTATGGG + Intergenic
1173869012 20:46330296-46330318 TGGCTCTGCCAGGAACTCACTGG + Intergenic
1173998457 20:47357488-47357510 TCGCCCTGCCACGATGCCAAGGG + Intergenic
1175813115 20:61869567-61869589 TGGCCCAGTCAGGGTCCCAAAGG + Intronic
1175953782 20:62597614-62597636 TGGCCCGGGCAGGACCCCAAAGG - Intergenic
1176053302 20:63132078-63132100 TGGCCCTGCCATGTGACCATGGG + Intergenic
1180376095 22:12095365-12095387 TCGCCCGGCCTGTATCCCATAGG + Intergenic
1182779080 22:32852991-32853013 TGGTCCTGGGAGGGTCCCATGGG + Intronic
1183339882 22:37274232-37274254 TGGCCCCTCCAGGATCTCACAGG + Intergenic
1184478982 22:44736349-44736371 TGGCCCTCCCACCATCCCCTTGG + Intronic
1184655595 22:45940539-45940561 TGGACCTCCCAGAATCCCAGGGG + Intronic
1184861392 22:47174930-47174952 TGGCCCTGCCCGCATTCCAGGGG - Exonic
950029126 3:9840377-9840399 TGGCCCTGCCCGGAGTCTATTGG - Intronic
952354176 3:32570087-32570109 TGGCCCTGACAGCTTCCCCTGGG - Intronic
954960094 3:54556857-54556879 TGGCCCTTCCACTGTCCCATGGG - Intronic
961332901 3:126153498-126153520 TGCCCATCCCAGGAGCCCATCGG - Exonic
963841056 3:150106970-150106992 TGGCCCTGTCAGGAGCCTACAGG + Intergenic
967682868 3:192385615-192385637 TGACACTGCCAGGGACCCATAGG + Intronic
968619907 4:1599355-1599377 CGGGCCAGCCAGGAGCCCATCGG + Intergenic
968943198 4:3650028-3650050 TGGACCTGCCTGGCTCCCAGGGG + Intergenic
969263115 4:6046183-6046205 TGGTCCTGCCAGGTTCTCAGGGG + Intronic
969418635 4:7076996-7077018 TGTCCCTGCCATGGTCCCCTGGG + Intergenic
969818377 4:9702894-9702916 AGGCCGGGCCAGGATCACATGGG + Intergenic
971027996 4:22607496-22607518 TGGCCATGGCAGGATCACAGAGG + Intergenic
976092289 4:81471447-81471469 TGGCCCTGCCCGGGTCCCAGCGG + Intronic
978741421 4:112142425-112142447 TAGCACTGCCAGTTTCCCATGGG - Intergenic
984885765 4:184447977-184447999 TGGCCGTGCCAGGGTCTCAATGG + Intronic
985348340 4:189031578-189031600 TGGCCCTGACAGGACCTCTTTGG + Intergenic
1202757693 4_GL000008v2_random:80806-80828 TCGCCCGGCCTGTATCCCATAGG + Intergenic
986173793 5:5334699-5334721 TGGCCCTGCCAGGACACCCAGGG - Intergenic
990439833 5:55833397-55833419 TGGTTGTGCCAGGATCCCCTTGG + Intergenic
994827525 5:104734193-104734215 TAGCCCTTCAAGGATTCCATGGG + Intergenic
1000035094 5:157440736-157440758 TGGCCCTGTTAGGATCCCATAGG - Intronic
1001201084 5:169717527-169717549 TTGCCCTGCCAGGATGCCTAGGG + Intronic
1002417388 5:179127620-179127642 TGGCATTGGCAGGATCGCATAGG - Intronic
1003169912 6:3712982-3713004 CAGCCCTGCCAGGCTCCCCTGGG - Intergenic
1003334659 6:5159187-5159209 CCCCCCTGCCAGGACCCCATGGG - Intronic
1003408335 6:5841197-5841219 TGGCTCTCCCTGGATCCCAGTGG - Intergenic
1005813549 6:29533064-29533086 TGGCCTTGCCAGGCACACATAGG - Intergenic
1007345073 6:41223075-41223097 TCTCCCTTCCAGGATCCCACAGG + Intergenic
1009428213 6:63537898-63537920 TGGGCCTGCCTGTATTCCATTGG - Intronic
1014612944 6:123567365-123567387 TGACTCTGCCAGCATACCATTGG - Intronic
1016988982 6:149916511-149916533 TGGCCCTGCCAGGAGCAGAGTGG - Intergenic
1017039946 6:150300185-150300207 TGGCTGTCCCAGGTTCCCATGGG - Intergenic
1021562355 7:21981230-21981252 TGGCATTGCCAGGCTCCCCTTGG + Intergenic
1023541444 7:41270864-41270886 GGGCCCTGCCAGCCTTCCATAGG - Intergenic
1024517180 7:50268831-50268853 TGGCCCTTCCAGTGCCCCATAGG + Intergenic
1026392210 7:69912766-69912788 TGACCCAGCCAGGATTGCATGGG + Intronic
1026802790 7:73410713-73410735 CGGGCCTGCCAGGAGCCCAGAGG + Intergenic
1027437214 7:78176512-78176534 GGTTCCTGCCAGGTTCCCATTGG + Intronic
1029116134 7:98238239-98238261 TGGCCCTGGCAGGCTCGCCTTGG + Intronic
1029530123 7:101119915-101119937 TGGTCCTGACACGCTCCCATTGG - Intergenic
1029551905 7:101240998-101241020 TGACCCTCCCAGGATCACAGAGG - Intronic
1029702562 7:102257100-102257122 GCGCCCTGCCTTGATCCCATGGG + Exonic
1035034326 7:155885288-155885310 TGGCCCTGCCAGGTGTCCCTAGG - Intergenic
1040284563 8:46093251-46093273 TGGCCCTGCCAGCATCCATGGGG - Intergenic
1048401701 8:134077301-134077323 TGTCTCTGCCAGGAACCCAAAGG + Intergenic
1049407401 8:142457848-142457870 GGGCCCTGCCAGGACCTCACAGG + Intronic
1055366688 9:75551565-75551587 TGGCAATGCCAGGATGCCACAGG + Intergenic
1057384301 9:94593827-94593849 TGGCCCTGCCAGGATCTCTAAGG + Intergenic
1059326575 9:113507433-113507455 AGGCCGTGCCTGGACCCCATGGG - Exonic
1059425860 9:114220540-114220562 TGACCCAGCCAGGCTCCCTTGGG + Intronic
1060217865 9:121749137-121749159 TGGCCCAGCTGGGATCCCAGGGG - Intronic
1061561974 9:131410404-131410426 TGGCCCTGCCAGCACCCCTGGGG - Intronic
1062130760 9:134891863-134891885 TGGCCCTGCCTGGGGCCCTTTGG + Intergenic
1062355123 9:136158254-136158276 TGGCCCTGCCAGTGTCCCCGGGG - Intergenic
1203538483 Un_KI270743v1:65670-65692 TCGCCCGGCCTGTATCCCATAGG + Intergenic
1186200570 X:7151761-7151783 TGGCAGTGCCAGCATCCCCTGGG + Intergenic
1192823200 X:74666241-74666263 TGGCCCTGGTAAGATCCCAAGGG + Intergenic
1196746366 X:119074126-119074148 CGGCCCTGCCTGGAACCCTTGGG - Intergenic
1200976620 Y:9218386-9218408 AGGCCTTGCCAGGCTCCCACAGG + Intergenic
1202134550 Y:21648166-21648188 AGGCCTTGCCAGGCTCCCACAGG - Intergenic