ID: 1080457737

View in Genome Browser
Species Human (GRCh38)
Location 11:32431111-32431133
Sequence TTCTCTGCAGCCGCCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080457737_1080457757 28 Left 1080457737 11:32431111-32431133 CCCCCGCCGGCGGCTGCAGAGAA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1080457757 11:32431162-32431184 GTGAGAGCTGAGGGGTGAAATGG 0: 1
1: 0
2: 3
3: 32
4: 411
1080457737_1080457745 -2 Left 1080457737 11:32431111-32431133 CCCCCGCCGGCGGCTGCAGAGAA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1080457745 11:32431132-32431154 AAGCCGGGAACCGCCTGGCCTGG 0: 1
1: 0
2: 1
3: 10
4: 131
1080457737_1080457747 2 Left 1080457737 11:32431111-32431133 CCCCCGCCGGCGGCTGCAGAGAA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1080457747 11:32431136-32431158 CGGGAACCGCCTGGCCTGGCCGG 0: 1
1: 0
2: 2
3: 16
4: 263
1080457737_1080457748 3 Left 1080457737 11:32431111-32431133 CCCCCGCCGGCGGCTGCAGAGAA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1080457748 11:32431137-32431159 GGGAACCGCCTGGCCTGGCCGGG 0: 1
1: 0
2: 7
3: 47
4: 507
1080457737_1080457744 -7 Left 1080457737 11:32431111-32431133 CCCCCGCCGGCGGCTGCAGAGAA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1080457744 11:32431127-32431149 CAGAGAAGCCGGGAACCGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 130
1080457737_1080457752 18 Left 1080457737 11:32431111-32431133 CCCCCGCCGGCGGCTGCAGAGAA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1080457752 11:32431152-32431174 TGGCCGGGCCGTGAGAGCTGAGG 0: 1
1: 0
2: 3
3: 14
4: 210
1080457737_1080457754 20 Left 1080457737 11:32431111-32431133 CCCCCGCCGGCGGCTGCAGAGAA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1080457754 11:32431154-32431176 GCCGGGCCGTGAGAGCTGAGGGG 0: 1
1: 0
2: 1
3: 13
4: 190
1080457737_1080457753 19 Left 1080457737 11:32431111-32431133 CCCCCGCCGGCGGCTGCAGAGAA 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1080457753 11:32431153-32431175 GGCCGGGCCGTGAGAGCTGAGGG 0: 1
1: 0
2: 3
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080457737 Original CRISPR TTCTCTGCAGCCGCCGGCGG GGG (reversed) Intronic
901074570 1:6545400-6545422 TTCTCTGGAGTCTCCTGCGGAGG - Intronic
903907110 1:26695539-26695561 TTCTCCGAAGCCTTCGGCGGCGG + Intergenic
913300879 1:117367409-117367431 TTCTCAGTGGCCGCCGGAGGAGG + Intergenic
915070516 1:153261775-153261797 TCCTCTGGAGGCGGCGGCGGCGG + Exonic
922785958 1:228282336-228282358 TGCTCTGCAGCAGCTGGGGGAGG - Intronic
924117522 1:240762627-240762649 TCCTCCGCAGCCGCCGGCCCGGG - Intergenic
924582885 1:245336573-245336595 TTCTCTGCAGGCTCGTGCGGCGG + Intronic
1066460421 10:35608160-35608182 TGGTCTGCAGCCTGCGGCGGCGG + Exonic
1067753627 10:48987451-48987473 TTCTCTGCAGGCCCCAGAGGGGG - Intergenic
1067806794 10:49398165-49398187 TTCTCCGCAGCAGCCGGGGGTGG - Intergenic
1070305093 10:75235021-75235043 AGCTCTGCAGCCCCAGGCGGGGG - Intronic
1073036465 10:100567324-100567346 TTCCCTGCAGCCGGCAGCGCTGG - Intergenic
1073297643 10:102450781-102450803 GTCGCTGCAGGCGCCCGCGGCGG - Exonic
1074130119 10:110566804-110566826 TTGTCTCCAGCAGCGGGCGGGGG + Intergenic
1074317150 10:112370449-112370471 CCCTCTGCAGCCGCTGGCCGGGG - Intergenic
1078586919 11:12599668-12599690 TTCTCCGCAGCGGCCGCCAGGGG + Intergenic
1078801025 11:14644111-14644133 GTCCCTGCAGCCGCCGGATGGGG + Exonic
1080457737 11:32431111-32431133 TTCTCTGCAGCCGCCGGCGGGGG - Intronic
1080791486 11:35525837-35525859 TCCTTTGCAGCCGCCGTCCGCGG - Intronic
1083256010 11:61495945-61495967 TTCTCAGCACCCGCAGGCTGTGG - Intergenic
1083264083 11:61538102-61538124 TTCTCTGCCGCCGCCGCCGCAGG + Intronic
1084275635 11:68049749-68049771 TCCTCCGCAGGCGGCGGCGGTGG - Exonic
1088916692 11:114232900-114232922 TTCTCTGCCACAGCTGGCGGAGG + Intronic
1091327436 11:134701653-134701675 TGGTCTGCAGCCGCCTCCGGTGG + Intergenic
1092125082 12:6069413-6069435 TTCTCTGCAGCCCCTGGAGGAGG - Intronic
1096771380 12:53938219-53938241 TTCTTTCCAGCCGCGAGCGGAGG + Intergenic
1100279925 12:93108574-93108596 CTGTCTGCAGCCGTCGGCGCTGG - Intergenic
1103780398 12:123395028-123395050 TTCTCTGCAGGCGGAGGTGGGGG - Exonic
1107364545 13:39656023-39656045 TGCTCTGCGGGCGCCGGGGGCGG + Intronic
1115473355 14:33791168-33791190 TCCTCTTCAGCCGCCCACGGTGG + Intronic
1116390527 14:44384881-44384903 CCCTCTGCAGCCGCTGGCCGGGG - Intergenic
1118514240 14:66508669-66508691 TTCTCTGCGGCCTCGGGAGGAGG + Intronic
1118718873 14:68579860-68579882 GTCTCTGCTGCAGCCGACGGTGG - Intronic
1119739704 14:77006372-77006394 TTCTCTGCAGTCTTGGGCGGTGG - Intergenic
1119808482 14:77498164-77498186 GGCTCTCCAGCCGCCGGCAGGGG - Intronic
1121492823 14:94372174-94372196 TTCTCTCCATCCCCTGGCGGGGG + Intergenic
1121874902 14:97442192-97442214 TTCTCTGCAGTCACCGGTGATGG - Intergenic
1124025864 15:25964891-25964913 ATCTCTGCAGCCGAGGGCTGAGG - Intergenic
1125092423 15:35810095-35810117 TGCTCTGCAGCCACCGGCTACGG + Intergenic
1125919577 15:43517634-43517656 TTCCCTGAAGCTGCCGGCTGAGG + Exonic
1132074076 15:98804984-98805006 TTCTCTGCAGCGGCCGGGAGTGG - Intronic
1132655119 16:1038645-1038667 TGCTCTGCAGCCCACGCCGGGGG + Intergenic
1132665142 16:1078127-1078149 TTCTCTGCAGCCGCCCCGTGGGG + Intergenic
1132729158 16:1352104-1352126 TTCGCTGCACCTGCCGGCGCGGG - Exonic
1132875472 16:2135228-2135250 GGCTCTGCAGACGCCAGCGGGGG - Intronic
1133867515 16:9658059-9658081 CTCTCAGCAGCCGGGGGCGGGGG + Intergenic
1136572623 16:31105802-31105824 CTCGCTGCTGCCCCCGGCGGCGG - Intergenic
1137590598 16:49691046-49691068 TTCTCAGAAGCAGCCGTCGGAGG + Intronic
1140478568 16:75250920-75250942 TTCACTCCGGCCGCCGGCGCGGG - Intronic
1142401494 16:89860983-89861005 GTCTCTGCTGCCGCCTGCTGGGG + Intronic
1142415151 16:89937050-89937072 TACACAGCAGCAGCCGGCGGAGG - Intergenic
1142491557 17:283158-283180 CTCTCTGCAGCCCCCCGCCGAGG + Intronic
1145110182 17:20155780-20155802 TTCTCAGCATCCGCGGGCGGAGG + Intronic
1147150368 17:38510555-38510577 GTCGCTGCGGCCCCCGGCGGCGG + Exonic
1147971018 17:44219180-44219202 TTCTCCCCGGCCGCCGGAGGGGG - Intronic
1149486393 17:57046116-57046138 TTCTCTTCATCTGCCGGTGGGGG - Intergenic
1153991705 18:10406257-10406279 TTCTCTGAAGCTGCCTGGGGAGG - Intergenic
1154199240 18:12287844-12287866 TCCGCTGCAGCTGCAGGCGGGGG + Intergenic
1156863660 18:41865896-41865918 TCCTCTGCAGCCGCTGGCCCGGG - Intergenic
1157491631 18:48127716-48127738 CTCTCTGCAGCCCCAGGCAGAGG - Intronic
1160462288 18:79048326-79048348 TTCTCTGCAGCCTATGGTGGGGG - Intergenic
1161429369 19:4222590-4222612 CTCTCTGCAGCCGCAGGAAGAGG - Intronic
1162751805 19:12833988-12834010 GTACCTGCAGCCTCCGGCGGCGG - Intronic
1162818647 19:13210169-13210191 TTCTCTGCAGCAGGCAGAGGAGG + Intronic
1164526780 19:29018808-29018830 CTCTCTGCAGCCTCAGGAGGGGG - Intergenic
1165304699 19:34996238-34996260 TCCTCTGCTGCTGCCGGCGTCGG - Intronic
1167643673 19:50695011-50695033 TTGTCTGCGGTCGGCGGCGGGGG - Intronic
938548035 2:132352921-132352943 TCCTGTGCAGCCGCCGCCGCCGG - Intergenic
946360819 2:219218509-219218531 TTCCCTGCAGACGCCGGGAGCGG - Exonic
946481620 2:220062342-220062364 TTCTCTGCAGAGGTCGGGGGAGG - Intergenic
946692397 2:222319458-222319480 TCCTCGGCAGGCGGCGGCGGCGG + Intergenic
946908360 2:224437339-224437361 TTCTCTGCAGCGTCCGGAGTTGG - Intergenic
947794007 2:232883131-232883153 TTCTATGGAGCCGCTGGGGGTGG - Intronic
1171876904 20:30585693-30585715 TCCTGTGCAGCCGCCGCCGCCGG - Intergenic
1172519857 20:35559500-35559522 TTCGCTGCTGCCGCCGCCTGAGG - Intergenic
1174357773 20:50009925-50009947 CTTTCTGCAGCCGCAGGCGGAGG + Intergenic
1175509739 20:59515812-59515834 GTCTCTCCAGCCGCCGCCAGAGG + Intergenic
1179154489 21:38838270-38838292 GTCTCTGCAGCCGGCTGGGGAGG + Intergenic
1179779101 21:43688069-43688091 TTTTCTGCAGCCTCCTGCGCTGG - Exonic
1181099845 22:20531854-20531876 TTCTGTGCAGCCGACAGCAGGGG + Intronic
1181877823 22:25954019-25954041 TTTTCTGCAGCCACAGGCAGTGG - Intronic
1183201757 22:36389830-36389852 TTCTTTGCAGCCGGGCGCGGTGG + Intergenic
1183422984 22:37723175-37723197 CTCTCTCCAGACACCGGCGGTGG + Exonic
1183588945 22:38769000-38769022 CTCGCTGCAGCCGGCGGCGCAGG - Intronic
1184186560 22:42868903-42868925 TTCTCTGCAGCCTGGGGCTGTGG + Intronic
1184218175 22:43081201-43081223 TTCTGTGCAGCCGGGCGCGGTGG - Intronic
1184308547 22:43625898-43625920 TCCTCTGCAGGGGCAGGCGGAGG - Intronic
1185066195 22:48632819-48632841 GTCTCTGCAGCCCCAGGCGGAGG + Intronic
1185263490 22:49884742-49884764 TTCCTTGCTGCCGCCGGAGGGGG + Exonic
950463056 3:13136670-13136692 TTCTCTGCTGCCTCGGGAGGTGG - Intergenic
956455168 3:69413801-69413823 TTCTCTGCAGCTCCCGGCATAGG - Intronic
960639549 3:119812799-119812821 CTCTCTGCAGCTGCGGGGGGAGG + Exonic
961012937 3:123448189-123448211 GTCGCGGCAGCCGCCGGCAGCGG - Exonic
961443186 3:126965024-126965046 GTCTCTGCAGCCCCAGGTGGCGG - Intergenic
968046599 3:195627469-195627491 CTCTCTGCAGCCGGCGTCTGAGG + Intergenic
968308054 3:197662571-197662593 CTCTCTGCAGCCGGCGTCTGAGG - Intergenic
983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG + Intronic
989567501 5:42915805-42915827 TTTTCAGCAGCTGCCGGAGGCGG - Intergenic
997282227 5:132656388-132656410 TCCTCCGCGGCCTCCGGCGGTGG - Intronic
997976797 5:138445758-138445780 TGCTCTGCAGCCTGCGGGGGTGG - Exonic
998328639 5:141304174-141304196 ATCCCTGCACCCGCAGGCGGGGG + Intergenic
998424193 5:142013002-142013024 GTCGCTGCAGCCGCCGCGGGAGG - Intronic
999868699 5:155728594-155728616 TTCTAGGCGGCGGCCGGCGGAGG + Intergenic
1001051313 5:168416624-168416646 TTCTCTTCAGCTGCTGGCTGTGG - Intronic
1004235542 6:13872142-13872164 TCCTCTGCAGCCGCTGGCCTGGG + Intergenic
1005327995 6:24720768-24720790 GCTTCTGCAGCCACCGGCGGGGG - Exonic
1007207534 6:40164733-40164755 ATCACTGCAGCTGCCGGGGGTGG - Intergenic
1008092858 6:47309773-47309795 TTCTCCTCAGCCGCTGTCGGAGG - Exonic
1012258915 6:97065005-97065027 TTCCCTGCAGGAGCCGGGGGAGG + Intronic
1013619083 6:111872216-111872238 ATCTCTGCGGCCACAGGCGGAGG - Intronic
1019456499 7:1130438-1130460 TTCGCTGCAGCAGCAGGCGTGGG - Intronic
1022943002 7:35257488-35257510 TTCTCTCCTGCCGCCAACGGTGG - Intergenic
1026236997 7:68535321-68535343 CCCTCTGCAGCTGCTGGCGGAGG + Intergenic
1029692741 7:102193052-102193074 TTCTCTGCAGCCCCAGGTTGGGG - Intronic
1033664104 7:143424617-143424639 CGCTCTGCAGCCGCTGGCGCGGG + Intergenic
1035053389 7:156017633-156017655 TCCTCTGCAGCTGCCGGCGCTGG - Intergenic
1036137188 8:6173232-6173254 TCCTGTGAAGCCGCCTGCGGAGG - Intergenic
1038413696 8:27377628-27377650 TTCTCTCCTGCCTCCGGAGGTGG - Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1049039048 8:140098698-140098720 TCCTCTGCAGCCGTCCGCAGAGG + Intronic
1049194714 8:141308692-141308714 CTCTCTGCAGCCGCAGGAGGTGG + Intergenic
1049230790 8:141480172-141480194 CTCGCTGCAGCCGCAGGCAGAGG - Intergenic
1054258374 9:62838119-62838141 TCCTGTGCAGCCGCCGCCGCCGG + Intergenic
1054333395 9:63781922-63781944 TCCTGTGCAGCCGCCGCCGCCGG - Intergenic
1057210180 9:93196886-93196908 TTCTCTGCAGGCCCAGGCAGAGG - Intronic
1058302190 9:103389785-103389807 TACTCTGCAGCCGGGCGCGGTGG + Intergenic
1061873871 9:133534520-133534542 TTGGCTGCTGCCGGCGGCGGCGG - Intronic
1202800401 9_KI270719v1_random:170257-170279 TCCTGTGCAGCCGCCGCCGCCGG - Intergenic
1186636912 X:11416130-11416152 TTCTGTGCTGCCGCAGGTGGGGG - Intronic
1193743322 X:85244357-85244379 TCCTCTTCAGCCGCAGCCGGGGG + Intronic
1200154622 X:153968959-153968981 TTCTCAGCAGCCCCCGGGCGGGG - Intronic