ID: 1080458339

View in Genome Browser
Species Human (GRCh38)
Location 11:32434550-32434572
Sequence GGATAGCGGAAGCGGCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080458339_1080458344 -10 Left 1080458339 11:32434550-32434572 CCCAGCCGCCGCTTCCGCTATCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1080458344 11:32434563-32434585 TCCGCTATCCTCACGGCCCTTGG 0: 1
1: 0
2: 1
3: 4
4: 77
1080458339_1080458356 28 Left 1080458339 11:32434550-32434572 CCCAGCCGCCGCTTCCGCTATCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1080458356 11:32434601-32434623 GAGCTGCGGTCAAAAGGGGTAGG 0: 1
1: 0
2: 0
3: 8
4: 95
1080458339_1080458346 -9 Left 1080458339 11:32434550-32434572 CCCAGCCGCCGCTTCCGCTATCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1080458346 11:32434564-32434586 CCGCTATCCTCACGGCCCTTGGG 0: 1
1: 0
2: 1
3: 3
4: 49
1080458339_1080458349 2 Left 1080458339 11:32434550-32434572 CCCAGCCGCCGCTTCCGCTATCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1080458349 11:32434575-32434597 ACGGCCCTTGGGAAGCAGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 137
1080458339_1080458352 14 Left 1080458339 11:32434550-32434572 CCCAGCCGCCGCTTCCGCTATCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1080458352 11:32434587-32434609 AAGCAGCTGGGTAAGAGCTGCGG 0: 1
1: 0
2: 1
3: 31
4: 276
1080458339_1080458353 22 Left 1080458339 11:32434550-32434572 CCCAGCCGCCGCTTCCGCTATCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1080458353 11:32434595-32434617 GGGTAAGAGCTGCGGTCAAAAGG 0: 1
1: 0
2: 0
3: 6
4: 77
1080458339_1080458348 1 Left 1080458339 11:32434550-32434572 CCCAGCCGCCGCTTCCGCTATCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1080458348 11:32434574-32434596 CACGGCCCTTGGGAAGCAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 221
1080458339_1080458354 23 Left 1080458339 11:32434550-32434572 CCCAGCCGCCGCTTCCGCTATCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1080458354 11:32434596-32434618 GGTAAGAGCTGCGGTCAAAAGGG 0: 1
1: 0
2: 1
3: 8
4: 109
1080458339_1080458355 24 Left 1080458339 11:32434550-32434572 CCCAGCCGCCGCTTCCGCTATCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1080458355 11:32434597-32434619 GTAAGAGCTGCGGTCAAAAGGGG 0: 1
1: 0
2: 1
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080458339 Original CRISPR GGATAGCGGAAGCGGCGGCT GGG (reversed) Intronic
900366776 1:2314832-2314854 GGGTAGCGGAAGAGGCGGCGGGG - Intergenic
901026541 1:6281379-6281401 GGTTAGGGGAAGCAGTGGCTTGG + Intronic
902861724 1:19251677-19251699 AGAAAGCGCAGGCGGCGGCTTGG + Exonic
907442611 1:54488432-54488454 GGAACGCCGAGGCGGCGGCTCGG - Intergenic
911902780 1:103526081-103526103 TGATATCGCAAGCGGCTGCTCGG - Exonic
920556635 1:206909357-206909379 GGATCGCGGCGGCGGCGGCGCGG + Intronic
1062916087 10:1242083-1242105 GGAAGGCGGACGCCGCGGCTGGG - Intronic
1066311902 10:34205679-34205701 GGATGGCGGCAGCAGAGGCTGGG + Intronic
1073426506 10:103458492-103458514 GAAGAGTGGAAGCGGCCGCTGGG - Exonic
1076050833 10:127332003-127332025 GGATGGAGGAACCGGTGGCTGGG + Intronic
1077140873 11:1024334-1024356 GGTTAGCGGCAGCGGCATCTTGG - Intronic
1078771851 11:14358901-14358923 GGCGGGCGGCAGCGGCGGCTCGG - Exonic
1080458339 11:32434550-32434572 GGATAGCGGAAGCGGCGGCTGGG - Intronic
1081465400 11:43312092-43312114 GGATAGCGGAACCGGGCCCTGGG + Exonic
1096073547 12:48788869-48788891 GGCTAGGGGAAGTGGCCGCTCGG - Intronic
1105217489 13:18297632-18297654 GGGCAGCGGCGGCGGCGGCTAGG + Intergenic
1117675595 14:58152105-58152127 GGACAGAGGCAGCGGCGGCGCGG + Exonic
1119522141 14:75294287-75294309 GCAGAGCGGAAGCGGCGGGCCGG - Intergenic
1120993495 14:90397927-90397949 AGAGGGCGGAAGCGGCGGCCGGG + Intronic
1121413455 14:93763242-93763264 GGATGCCGGAAGCTGAGGCTCGG - Intronic
1121812764 14:96906199-96906221 GGATTGCGGAGGCTGAGGCTTGG + Intronic
1128233299 15:66050322-66050344 GGAAAGGGGAAGAGGGGGCTGGG + Intronic
1129710992 15:77820124-77820146 GGAGAGCGGAGGGGGCGGCGGGG - Intronic
1131475398 15:92734255-92734277 GGAGAGCGGCGGCGGCGGCGCGG - Intronic
1142762771 17:2051350-2051372 GGGGCGCGGAAGCGGCGGCGGGG + Intergenic
1143918021 17:10309151-10309173 GGATAGCGGAAGCAGCTGCACGG + Intronic
1146198328 17:30832180-30832202 AGAGAGCGGGAGCGGAGGCTGGG - Exonic
1148178080 17:45584879-45584901 GGGCAGCGGCAGCGGCGGCGGGG + Intergenic
1150258996 17:63773479-63773501 CGATCGCGGAGGCGGCGGCCAGG - Exonic
1152121480 17:78421506-78421528 GGATAGGTGGAGCGGCGGCCTGG + Intronic
1152320417 17:79605936-79605958 GGGTAGAGAAAGCTGCGGCTTGG - Intergenic
1154132761 18:11750967-11750989 GGGTAGGGGAAGCGCCGCCTGGG + Intronic
1160957628 19:1700680-1700702 CGATAGCCGAGGCGGCCGCTGGG + Intergenic
1161335495 19:3710650-3710672 GGTTAGCGGAAGCCTAGGCTGGG + Intronic
1161703096 19:5805374-5805396 GGATGGCGGTCGCGGCGGCTGGG + Intergenic
932657026 2:73619161-73619183 GGAGAGCAGAAGTGGCTGCTTGG - Intergenic
932663690 2:73679413-73679435 GGAAAGCAGAAGTGGCTGCTTGG - Intergenic
937395461 2:121530695-121530717 GGGTCGCAAAAGCGGCGGCTCGG - Intronic
1171432486 20:25091847-25091869 GGCTAGCAGAAGCGGCAGCATGG + Intergenic
1174045591 20:47730311-47730333 GGATGGCAGAAGCTGGGGCTGGG + Intronic
1175127386 20:56762677-56762699 GGAAAATGGAAGCGGCAGCTTGG + Intergenic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1180914887 22:19479154-19479176 CGGCAGCGGCAGCGGCGGCTGGG - Exonic
952241181 3:31532814-31532836 GGGTGGAGGAAGCGGCGGCGGGG - Exonic
963733139 3:148991697-148991719 GGAGAAGGGAGGCGGCGGCTGGG - Intronic
966872850 3:184302936-184302958 GGATAGCAGAAGGGACAGCTGGG + Intronic
985674291 5:1222867-1222889 GGGAAGCGGAAGCTGCAGCTGGG + Exonic
1001585969 5:172834196-172834218 GGGTGGCGGAAGGGGCGGCCGGG + Intergenic
1006466124 6:34196001-34196023 AGATGGCGGAAGCTGGGGCTTGG - Intergenic
1007424076 6:41735543-41735565 TGACAGCGGAGGCGGCGGCCCGG - Intronic
1007747745 6:44053478-44053500 GGACAGAGGAAGTGGAGGCTGGG + Intergenic
1007749632 6:44064081-44064103 GGACAGAGGAAGTGGAGGCTGGG - Intergenic
1018683754 6:166285862-166285884 GGATAGAGGAAGCGGCAGTCAGG + Intergenic
1018730446 6:166646265-166646287 GCAGAACAGAAGCGGCGGCTGGG + Intronic
1020178099 7:5898798-5898820 GGATGGCTGCAGCGGCGGCCGGG + Exonic
1020304828 7:6826177-6826199 GGATGGCTGCAGCGGCGGCCGGG - Exonic
1022226643 7:28370234-28370256 GGATACCTGAAGCTGAGGCTAGG - Intronic
1028898046 7:96063999-96064021 GGTTAGCGGGAGAGGTGGCTTGG + Intronic
1029080759 7:97972234-97972256 GGATGGCTGCAGCGGCGGCCGGG - Intergenic
1029958699 7:104667449-104667471 GGAGAGTAGAAGCGGCCGCTGGG - Intronic
1035581014 8:738878-738900 GGAGAGCGGACGCGGGGGCGAGG + Intergenic
1037986299 8:23292711-23292733 GGAGAGCCGAAGGGGTGGCTAGG + Intronic
1041227664 8:55716666-55716688 GGATAGAGGAAGCAGCAGATAGG + Intronic
1049094337 8:140539632-140539654 GGATGCAGGAAGCGGGGGCTTGG + Intronic
1055436097 9:76293709-76293731 GGAGAGCTGAAGAGGCGGCCAGG - Intronic
1057834840 9:98436039-98436061 GGATAGGGGTGGCGGCTGCTGGG - Intronic
1061726091 9:132582726-132582748 GGGCAGGGGCAGCGGCGGCTGGG + Exonic
1061937138 9:133864068-133864090 CGATATCGGAAGAGTCGGCTGGG - Intronic
1062615472 9:137394106-137394128 GGGTTAGGGAAGCGGCGGCTGGG - Intronic
1062615632 9:137394541-137394563 GGATTAGGGAAGCGGAGGCTGGG - Intronic
1190099725 X:47513339-47513361 GGACCGCGGCAGAGGCGGCTCGG + Intergenic
1196477736 X:116108444-116108466 GGATAGCGGAAGCGGGCCCTGGG - Intergenic
1197327406 X:125110563-125110585 GGATAGGGGAAACAGCAGCTAGG - Intergenic
1200178699 X:154137035-154137057 GGTGAGCGGCGGCGGCGGCTCGG - Intergenic