ID: 1080461516

View in Genome Browser
Species Human (GRCh38)
Location 11:32458883-32458905
Sequence CTGCAGAGCCATAATGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080461516_1080461526 30 Left 1080461516 11:32458883-32458905 CCAGGCTCATTATGGCTCTGCAG No data
Right 1080461526 11:32458936-32458958 AAAAGGAAAGCATCTGGAGATGG No data
1080461516_1080461519 -10 Left 1080461516 11:32458883-32458905 CCAGGCTCATTATGGCTCTGCAG No data
Right 1080461519 11:32458896-32458918 GGCTCTGCAGGAAATAGCATGGG No data
1080461516_1080461523 13 Left 1080461516 11:32458883-32458905 CCAGGCTCATTATGGCTCTGCAG No data
Right 1080461523 11:32458919-32458941 TCCAGGGACTAATGTGGAAAAGG No data
1080461516_1080461521 -3 Left 1080461516 11:32458883-32458905 CCAGGCTCATTATGGCTCTGCAG No data
Right 1080461521 11:32458903-32458925 CAGGAAATAGCATGGGTCCAGGG No data
1080461516_1080461525 24 Left 1080461516 11:32458883-32458905 CCAGGCTCATTATGGCTCTGCAG No data
Right 1080461525 11:32458930-32458952 ATGTGGAAAAGGAAAGCATCTGG No data
1080461516_1080461520 -4 Left 1080461516 11:32458883-32458905 CCAGGCTCATTATGGCTCTGCAG No data
Right 1080461520 11:32458902-32458924 GCAGGAAATAGCATGGGTCCAGG No data
1080461516_1080461522 7 Left 1080461516 11:32458883-32458905 CCAGGCTCATTATGGCTCTGCAG No data
Right 1080461522 11:32458913-32458935 CATGGGTCCAGGGACTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080461516 Original CRISPR CTGCAGAGCCATAATGAGCC TGG (reversed) Intergenic
No off target data available for this crispr