ID: 1080461521

View in Genome Browser
Species Human (GRCh38)
Location 11:32458903-32458925
Sequence CAGGAAATAGCATGGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080461513_1080461521 13 Left 1080461513 11:32458867-32458889 CCGAGCGATAGAGGACCCAGGCT No data
Right 1080461521 11:32458903-32458925 CAGGAAATAGCATGGGTCCAGGG No data
1080461516_1080461521 -3 Left 1080461516 11:32458883-32458905 CCAGGCTCATTATGGCTCTGCAG No data
Right 1080461521 11:32458903-32458925 CAGGAAATAGCATGGGTCCAGGG No data
1080461515_1080461521 -2 Left 1080461515 11:32458882-32458904 CCCAGGCTCATTATGGCTCTGCA No data
Right 1080461521 11:32458903-32458925 CAGGAAATAGCATGGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080461521 Original CRISPR CAGGAAATAGCATGGGTCCA GGG Intergenic
No off target data available for this crispr