ID: 1080461522

View in Genome Browser
Species Human (GRCh38)
Location 11:32458913-32458935
Sequence CATGGGTCCAGGGACTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080461516_1080461522 7 Left 1080461516 11:32458883-32458905 CCAGGCTCATTATGGCTCTGCAG No data
Right 1080461522 11:32458913-32458935 CATGGGTCCAGGGACTAATGTGG No data
1080461515_1080461522 8 Left 1080461515 11:32458882-32458904 CCCAGGCTCATTATGGCTCTGCA No data
Right 1080461522 11:32458913-32458935 CATGGGTCCAGGGACTAATGTGG No data
1080461513_1080461522 23 Left 1080461513 11:32458867-32458889 CCGAGCGATAGAGGACCCAGGCT No data
Right 1080461522 11:32458913-32458935 CATGGGTCCAGGGACTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080461522 Original CRISPR CATGGGTCCAGGGACTAATG TGG Intergenic
No off target data available for this crispr