ID: 1080461525

View in Genome Browser
Species Human (GRCh38)
Location 11:32458930-32458952
Sequence ATGTGGAAAAGGAAAGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080461516_1080461525 24 Left 1080461516 11:32458883-32458905 CCAGGCTCATTATGGCTCTGCAG No data
Right 1080461525 11:32458930-32458952 ATGTGGAAAAGGAAAGCATCTGG No data
1080461515_1080461525 25 Left 1080461515 11:32458882-32458904 CCCAGGCTCATTATGGCTCTGCA No data
Right 1080461525 11:32458930-32458952 ATGTGGAAAAGGAAAGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080461525 Original CRISPR ATGTGGAAAAGGAAAGCATC TGG Intergenic
No off target data available for this crispr