ID: 1080461526

View in Genome Browser
Species Human (GRCh38)
Location 11:32458936-32458958
Sequence AAAAGGAAAGCATCTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080461524_1080461526 -7 Left 1080461524 11:32458920-32458942 CCAGGGACTAATGTGGAAAAGGA No data
Right 1080461526 11:32458936-32458958 AAAAGGAAAGCATCTGGAGATGG No data
1080461516_1080461526 30 Left 1080461516 11:32458883-32458905 CCAGGCTCATTATGGCTCTGCAG No data
Right 1080461526 11:32458936-32458958 AAAAGGAAAGCATCTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080461526 Original CRISPR AAAAGGAAAGCATCTGGAGA TGG Intergenic
No off target data available for this crispr