ID: 1080461625

View in Genome Browser
Species Human (GRCh38)
Location 11:32459690-32459712
Sequence GGAAAATCAAGCCTAAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080461625_1080461631 19 Left 1080461625 11:32459690-32459712 CCTCAGCTTAGGCTTGATTTTCC No data
Right 1080461631 11:32459732-32459754 ACTGGAACAGATAATCTCTAAGG No data
1080461625_1080461628 1 Left 1080461625 11:32459690-32459712 CCTCAGCTTAGGCTTGATTTTCC No data
Right 1080461628 11:32459714-32459736 GGCCCATAAAATGAAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080461625 Original CRISPR GGAAAATCAAGCCTAAGCTG AGG (reversed) Intergenic
No off target data available for this crispr