ID: 1080463646

View in Genome Browser
Species Human (GRCh38)
Location 11:32477126-32477148
Sequence TTGAAGAAGCAGAGTCAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080463643_1080463646 -10 Left 1080463643 11:32477113-32477135 CCTGAAGAATTCCTTGAAGAAGC No data
Right 1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG No data
1080463639_1080463646 28 Left 1080463639 11:32477075-32477097 CCTCGGGCCCTGGGTCTGGAGTT No data
Right 1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG No data
1080463641_1080463646 21 Left 1080463641 11:32477082-32477104 CCCTGGGTCTGGAGTTCGTGGCT No data
Right 1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG No data
1080463642_1080463646 20 Left 1080463642 11:32477083-32477105 CCTGGGTCTGGAGTTCGTGGCTA No data
Right 1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080463646 Original CRISPR TTGAAGAAGCAGAGTCAGGC CGG Intergenic
No off target data available for this crispr