ID: 1080465008

View in Genome Browser
Species Human (GRCh38)
Location 11:32488279-32488301
Sequence CTGGCCCCAGCCTGTTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080464997_1080465008 26 Left 1080464997 11:32488230-32488252 CCATCTTTGCCTCCCAAAGTGTT 0: 3
1: 467
2: 11064
3: 94993
4: 229484
Right 1080465008 11:32488279-32488301 CTGGCCCCAGCCTGTTTTGCAGG No data
1080465000_1080465008 17 Left 1080465000 11:32488239-32488261 CCTCCCAAAGTGTTGGGATTACA 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
Right 1080465008 11:32488279-32488301 CTGGCCCCAGCCTGTTTTGCAGG No data
1080465002_1080465008 14 Left 1080465002 11:32488242-32488264 CCCAAAGTGTTGGGATTACAGGC 0: 16492
1: 240790
2: 271963
3: 174140
4: 134914
Right 1080465008 11:32488279-32488301 CTGGCCCCAGCCTGTTTTGCAGG No data
1080464995_1080465008 30 Left 1080464995 11:32488226-32488248 CCACCCATCTTTGCCTCCCAAAG 0: 19
1: 2131
2: 32094
3: 111302
4: 184553
Right 1080465008 11:32488279-32488301 CTGGCCCCAGCCTGTTTTGCAGG No data
1080465003_1080465008 13 Left 1080465003 11:32488243-32488265 CCAAAGTGTTGGGATTACAGGCA 0: 7114
1: 109335
2: 242763
3: 237820
4: 206209
Right 1080465008 11:32488279-32488301 CTGGCCCCAGCCTGTTTTGCAGG No data
1080464996_1080465008 27 Left 1080464996 11:32488229-32488251 CCCATCTTTGCCTCCCAAAGTGT 0: 2
1: 328
2: 7001
3: 62230
4: 211505
Right 1080465008 11:32488279-32488301 CTGGCCCCAGCCTGTTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080465008 Original CRISPR CTGGCCCCAGCCTGTTTTGC AGG Intergenic
No off target data available for this crispr