ID: 1080471829

View in Genome Browser
Species Human (GRCh38)
Location 11:32553237-32553259
Sequence TGACCTCTGTTGACACCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080471829_1080471832 -1 Left 1080471829 11:32553237-32553259 CCATGTGGTGTCAACAGAGGTCA No data
Right 1080471832 11:32553259-32553281 ACTTGGAAGTATTCAGCTGGTGG No data
1080471829_1080471833 0 Left 1080471829 11:32553237-32553259 CCATGTGGTGTCAACAGAGGTCA No data
Right 1080471833 11:32553260-32553282 CTTGGAAGTATTCAGCTGGTGGG No data
1080471829_1080471831 -4 Left 1080471829 11:32553237-32553259 CCATGTGGTGTCAACAGAGGTCA No data
Right 1080471831 11:32553256-32553278 GTCACTTGGAAGTATTCAGCTGG No data
1080471829_1080471834 16 Left 1080471829 11:32553237-32553259 CCATGTGGTGTCAACAGAGGTCA No data
Right 1080471834 11:32553276-32553298 TGGTGGGTGAGCTTATCTGCAGG No data
1080471829_1080471835 27 Left 1080471829 11:32553237-32553259 CCATGTGGTGTCAACAGAGGTCA No data
Right 1080471835 11:32553287-32553309 CTTATCTGCAGGATCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080471829 Original CRISPR TGACCTCTGTTGACACCACA TGG (reversed) Intergenic
No off target data available for this crispr