ID: 1080475200

View in Genome Browser
Species Human (GRCh38)
Location 11:32583878-32583900
Sequence GGCCTGCACCATGAGCGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080475192_1080475200 25 Left 1080475192 11:32583830-32583852 CCTTTTCCGGTCGGCGTGGTCTT 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1080475200 11:32583878-32583900 GGCCTGCACCATGAGCGTCCCGG 0: 1
1: 0
2: 2
3: 27
4: 113
1080475193_1080475200 19 Left 1080475193 11:32583836-32583858 CCGGTCGGCGTGGTCTTGCGAGT 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1080475200 11:32583878-32583900 GGCCTGCACCATGAGCGTCCCGG 0: 1
1: 0
2: 2
3: 27
4: 113
1080475191_1080475200 26 Left 1080475191 11:32583829-32583851 CCCTTTTCCGGTCGGCGTGGTCT 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1080475200 11:32583878-32583900 GGCCTGCACCATGAGCGTCCCGG 0: 1
1: 0
2: 2
3: 27
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080475200 Original CRISPR GGCCTGCACCATGAGCGTCC CGG Exonic
900674545 1:3876798-3876820 GGCCTGCACAGAGAGCGTCCAGG + Intronic
901023235 1:6265552-6265574 GGCATGAACCAGGACCGTCCTGG - Intronic
901040068 1:6358389-6358411 GGGCTGCACAAGGAGCCTCCTGG - Intronic
901961323 1:12828610-12828632 GGCCTGCACCATCAGCTTCAGGG + Exonic
901962881 1:12841187-12841209 GGCCTGCACCATCAGCTTCAGGG + Intergenic
901967915 1:12883215-12883237 GGACTGCACCATCAGCTTCAGGG + Exonic
901969452 1:12895674-12895696 GGCCTGCACCATCAGCTTCAGGG + Exonic
901975719 1:12942345-12942367 GGCCTGCACCATCAGCTTCAGGG + Exonic
901983313 1:13053480-13053502 GGCCTGCACCATCAGCTTCAGGG + Intronic
901985697 1:13073851-13073873 GGCCTGTACCATCAGCTTCAGGG - Exonic
901990071 1:13105490-13105512 GGCCTGCACCATCAGCTTCAGGG + Intergenic
901996112 1:13152916-13152938 GGCCTGTACCATCAGCTTCAGGG + Intergenic
901998775 1:13175438-13175460 GGCCTGCACCATCAGCTTCAGGG - Intergenic
902007776 1:13246014-13246036 GGCCTGCACCATCAGCTTCAGGG - Intergenic
902009455 1:13259420-13259442 GGCCTGCACCATCAGCTTCAGGG - Exonic
902015720 1:13306106-13306128 GGCCTGCACCATCAGCTTCAGGG - Intronic
902017261 1:13318565-13318587 GGCCTGCACCATCAGCTTCAGGG - Exonic
902026752 1:13389809-13389831 GGCCTGCACCATCAGCTTCAGGG - Exonic
902030173 1:13416506-13416528 GGCCTGCACCATCAGCTTCAGGG - Exonic
903853589 1:26322299-26322321 GGCCCCCACCATGAGCCTACAGG - Exonic
907243401 1:53092864-53092886 GGCCTTCCCCCTGAGCTTCCTGG + Intronic
908027498 1:59968420-59968442 GGCCTCAGCCATGAGGGTCCAGG - Intergenic
915061403 1:153188787-153188809 TGCCTACACCATGAGGGTCCTGG - Intergenic
915500368 1:156312064-156312086 GGCCTGCACCATTCTCCTCCGGG - Exonic
915516003 1:156413078-156413100 GGCTTCTACCATGAGCCTCCTGG + Intronic
916605365 1:166337363-166337385 GGGCTGCACTATGATGGTCCTGG - Intergenic
917581847 1:176386762-176386784 GGTCTGCACCCTCAGCCTCCTGG - Intergenic
924070845 1:240276670-240276692 AGTCTGCACCATGAGGGTCATGG - Intronic
924624123 1:245686040-245686062 GGCCTCACCCAGGAGCGTCCCGG + Exonic
1065917277 10:30364569-30364591 AGCCTGCACCAGGAGAGGCCAGG - Intronic
1069711966 10:70495365-70495387 GATCTGCTCCATGAGGGTCCGGG + Intronic
1071072026 10:81705343-81705365 GGGCTGCACCATCAGCTCCCTGG + Intergenic
1075337092 10:121616438-121616460 GGCTTGCACCGTGGGCCTCCTGG - Intergenic
1075792310 10:125093751-125093773 GTGCTGCCCCCTGAGCGTCCTGG - Intronic
1076133233 10:128028086-128028108 GGTCTGCACCATCAGTGTCCTGG - Intronic
1076685542 10:132196962-132196984 CGCCTGCACCAGCAGCGGCCTGG - Intronic
1080475200 11:32583878-32583900 GGCCTGCACCATGAGCGTCCCGG + Exonic
1083895190 11:65616258-65616280 GGCCGCCCCCATGAGGGTCCCGG + Exonic
1083935066 11:65865740-65865762 GGCCAGCACCATGAGGGGCCAGG - Intronic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1084183616 11:67458722-67458744 GGCCTCCCCCAGGAGCCTCCAGG + Exonic
1089443257 11:118532951-118532973 GGCCTGGGCCCTGAGCTTCCTGG - Exonic
1090173198 11:124623074-124623096 GGGCTGGACCATGAGCCTGCTGG + Exonic
1096693179 12:53333467-53333489 GCACTGCACCATGAGCTCCCTGG - Intronic
1104429541 12:128705450-128705472 GGCCAGCACCATGAGCGCACAGG + Exonic
1110879452 13:80553304-80553326 GGGCTCCACCATGACCCTCCAGG - Intergenic
1111498285 13:89083120-89083142 GGTCTGCACAGTGAGGGTCCTGG + Intergenic
1114957733 14:27845438-27845460 GCCCTGCACTCTGAGCGGCCAGG + Intergenic
1115265332 14:31494437-31494459 TGCCTGCACCATCAGGGGCCTGG + Intronic
1121047573 14:90799283-90799305 GGCCTGGGCCATCAGGGTCCTGG + Intronic
1122362663 14:101176527-101176549 GCCCTGTATCAGGAGCGTCCAGG - Intergenic
1122463954 14:101917848-101917870 AGCCAGCACCATGAGCATTCCGG + Exonic
1122904897 14:104797124-104797146 AACCTGCACCATGAGCCACCTGG + Intergenic
1123922456 15:25080027-25080049 AGCCTACACCATGTGTGTCCAGG - Intergenic
1126904375 15:53348563-53348585 GGCCTTAATCATAAGCGTCCTGG + Intergenic
1129038735 15:72666248-72666270 AGCCTGCACCAGGAGCGGCCAGG + Exonic
1129211155 15:74070982-74071004 AGCCTGCACCAGGAGCGGCCAGG - Exonic
1129399248 15:75270105-75270127 AGCCTGCACCAGGAGCGGCCAGG + Exonic
1129402855 15:75294381-75294403 AGCCTGCACCAGGAGTGGCCAGG + Exonic
1129476390 15:75786802-75786824 AGCCTGCACCGGGAGCGGCCGGG + Intergenic
1129728288 15:77915256-77915278 AGCCTGCACCAGGAGCGGCCAGG - Intergenic
1130099647 15:80882960-80882982 GGCTTGCAGCAGGAGCTTCCTGG + Intronic
1131693679 15:94854072-94854094 GGCATGCTCCATGAACATCCTGG + Intergenic
1133170369 16:3979226-3979248 GGCCTGCACCAAGCGCCTGCTGG - Exonic
1141998358 16:87648903-87648925 GGCCAGCAGCATCTGCGTCCTGG - Intronic
1142069596 16:88083846-88083868 GGGCTGCACCCTGAGTCTCCCGG + Intronic
1142111059 16:88331899-88331921 AGCCTGCATCCTGAGCTTCCAGG - Intergenic
1144020981 17:11240413-11240435 GCCCCGCACCCTGAGCGCCCGGG + Intergenic
1148451123 17:47778412-47778434 GGCCTGCGCCCTGAGCGGCGCGG + Intergenic
1149430708 17:56594074-56594096 GGCCGGCAGCATGAGCCGCCGGG - Exonic
1150127947 17:62650714-62650736 GGCATTAACCATGCGCGTCCAGG - Intronic
1151423488 17:74014397-74014419 AGCCTGCACCACGAGCATCTGGG + Intergenic
1152861407 17:82698584-82698606 GGCCGTCACGATGAGCGCCCTGG - Exonic
1159123919 18:64201105-64201127 GGCCTGAACCAAGAGGGGCCAGG - Intergenic
1161343320 19:3754219-3754241 GGCCTGGGCCATGCGCGTGCTGG + Exonic
1161682618 19:5687609-5687631 GGCCATCACCATGTGCGTCCTGG + Exonic
1163130690 19:15270997-15271019 TGCCTGGACCAAGAACGTCCTGG + Intronic
1163743933 19:19033686-19033708 GGCGACCACCGTGAGCGTCCCGG + Exonic
1168403533 19:56099280-56099302 AGTCTGCACCCTGAGCGACCTGG + Intronic
925142401 2:1559208-1559230 TTCCTGCACTATGAGTGTCCGGG + Intergenic
926087314 2:10028579-10028601 GGCCTGGAGCATGAGGGGCCTGG - Intergenic
927939491 2:27094785-27094807 GGCCTCCACCCTAAGCTTCCTGG + Intronic
932056468 2:68448499-68448521 GGCCTGCACCCTGAGGCTCTGGG - Intergenic
933236628 2:79871437-79871459 GGCCTGCACCAGTAGCCTCCTGG - Intronic
935942157 2:108251414-108251436 GGCCTTTACAATGAGCGACCTGG + Intronic
946569251 2:221003976-221003998 GGCCTCTACCATGTGCTTCCTGG - Intergenic
947915339 2:233828807-233828829 GGCCTGCACCCTCAGCTCCCGGG - Intronic
949034916 2:241811898-241811920 AGCCTGCACCGTGAGCGTCCTGG - Intronic
949078670 2:242079087-242079109 GGACTGCACCATCAGTGCCCTGG + Intergenic
1169218270 20:3805702-3805724 GGCCTGAATCATGAGCCTGCTGG + Exonic
1170546081 20:17436840-17436862 GGCCTGCAGCGTGAGCTCCCGGG - Exonic
1172395909 20:34604988-34605010 AGACTGCACCATGAGCATCTCGG + Intronic
1175310989 20:58011488-58011510 GGCCTGCTCCCACAGCGTCCTGG + Intergenic
1176369570 21:6054129-6054151 GGCCTGCACCATCAGCCCTCAGG - Intergenic
1176513085 21:7763330-7763352 GACCTGGACCTTGAGGGTCCAGG + Intronic
1178647198 21:34393854-34393876 GACCTGGACCTTGAGGGTCCAGG + Intronic
1179753949 21:43484412-43484434 GGCCTGCACCATCAGCCCTCAGG + Intergenic
1180621186 22:17163417-17163439 GGTCAGCAGCATGAGCATCCTGG - Intronic
1182226163 22:28800399-28800421 GGCTGGCACCATGAGCGGCAGGG + Exonic
1184448278 22:44567108-44567130 GTCCTGCTCCACGAGCTTCCGGG + Intergenic
1184667324 22:45995912-45995934 GCCCCGCACCATGAGTGGCCAGG + Intergenic
1185000332 22:48241675-48241697 GGCCTGCACCAAGAGCTCCGAGG - Intergenic
953212155 3:40885577-40885599 GGCCTGTGCCATGTGCCTCCTGG - Intergenic
954384314 3:50236338-50236360 GGGCTGCACCGTGAGCGCCGAGG + Exonic
961188333 3:124935438-124935460 GGCCTGCCCAATGAGTGGCCAGG - Intronic
961793360 3:129392427-129392449 GGCCTGATCCCTGAGCCTCCAGG + Intergenic
961977467 3:131042122-131042144 GGCCTACACCACAAGCGCCCTGG + Intronic
962383064 3:134912442-134912464 GGCCTGCACCATCAGCATGCTGG + Intronic
968507745 4:979519-979541 GGCCTCCACCATGCCCTTCCCGG - Intronic
968516371 4:1017289-1017311 GAGCTGGACCAAGAGCGTCCTGG - Intronic
971653015 4:29303977-29303999 GGGCTGCTCCATCAGCCTCCTGG + Intergenic
979705318 4:123713605-123713627 TGCCTACACCATGAGGGCCCTGG + Intergenic
985754224 5:1703641-1703663 GCCCAGCACCATGATCCTCCTGG + Intergenic
990516585 5:56536034-56536056 GCCCTGCAAGATGAGCCTCCTGG + Intronic
993317462 5:86428972-86428994 GACCCGCACCAGGAGCCTCCTGG - Intergenic
996072371 5:119147880-119147902 GGCCAGCAGCATCAGCGTCCTGG + Intronic
1006451155 6:34106506-34106528 GACCTGCACCATTAGCCCCCTGG + Intronic
1007771084 6:44192775-44192797 GGCCTGCACCTTAGGAGTCCAGG - Intergenic
1011842370 6:91517430-91517452 GGCCTGCCACATGAGAGACCAGG + Intergenic
1014575420 6:123063909-123063931 GGCCTGAACCATGGGGGCCCTGG + Exonic
1019943095 7:4306571-4306593 GTCCTGCACCAGGAGAGCCCTGG + Intergenic
1020116713 7:5480241-5480263 GCCCTTCACCAAGAGCGGCCAGG + Intronic
1023820133 7:43975999-43976021 AGCCTGCACCATGGGTGGCCAGG + Intergenic
1027790345 7:82633414-82633436 TGCCTGCACCACCAGCGCCCTGG + Intergenic
1029748412 7:102529452-102529474 AGCCTGCACCATGGGTGGCCAGG + Intergenic
1029766359 7:102628539-102628561 AGCCTGCACCATGGGTGGCCAGG + Intronic
1032097922 7:128948746-128948768 GGCCTGCTCCAGGAGGGGCCTGG - Exonic
1035536936 8:399108-399130 GGACTGCACCATCAGTGCCCTGG + Intergenic
1042229521 8:66542088-66542110 GGCCCGCCCCAGGAGCGCCCAGG - Intergenic
1043036719 8:75208453-75208475 TGCCTACACCATCAGGGTCCTGG - Intergenic
1048809325 8:138270870-138270892 GGCCTCCACCCTGAGCTCCCAGG - Intronic
1049298204 8:141855063-141855085 AGCCTGCACCCTGAGTCTCCTGG + Intergenic
1049357623 8:142196513-142196535 GATGTGCACCATGAGCTTCCGGG - Intergenic
1050642240 9:7680744-7680766 GGGCTGCATCATGGGCTTCCTGG - Intergenic
1052265888 9:26572587-26572609 GACCTGTACCATTAGGGTCCAGG - Intergenic
1052336444 9:27324726-27324748 TGCCTTCACCATGAGGGCCCTGG - Intergenic
1052448295 9:28591913-28591935 GGGCTTCACAATGAGCTTCCTGG + Intronic
1056732568 9:89178487-89178509 GGCCGGCACCAGCAGCGCCCGGG - Exonic
1061587443 9:131578164-131578186 GGCCTCCAGCATGAGCCTGCAGG - Exonic
1192018420 X:67357771-67357793 GGCCTACACCACGAGGGCCCTGG + Intergenic
1195239508 X:102937309-102937331 GGCCAGCACGATGAGCGCCCCGG + Exonic
1195298199 X:103500744-103500766 GGCCAGCACCATGAGCGCCCCGG - Exonic
1200118609 X:153780215-153780237 GGGCTGCATCATGAGAGACCAGG - Intronic