ID: 1080475264

View in Genome Browser
Species Human (GRCh38)
Location 11:32584136-32584158
Sequence ACGCTTCACCGCCAGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080475254_1080475264 13 Left 1080475254 11:32584100-32584122 CCAGCTCGCCGGCCGGCGGTCCC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1080475264 11:32584136-32584158 ACGCTTCACCGCCAGCTCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 131
1080475249_1080475264 30 Left 1080475249 11:32584083-32584105 CCTGGCCTCGATTCGCACCAGCT 0: 1
1: 0
2: 1
3: 2
4: 67
Right 1080475264 11:32584136-32584158 ACGCTTCACCGCCAGCTCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 131
1080475250_1080475264 25 Left 1080475250 11:32584088-32584110 CCTCGATTCGCACCAGCTCGCCG 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1080475264 11:32584136-32584158 ACGCTTCACCGCCAGCTCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 131
1080475256_1080475264 5 Left 1080475256 11:32584108-32584130 CCGGCCGGCGGTCCCAGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1080475264 11:32584136-32584158 ACGCTTCACCGCCAGCTCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 131
1080475259_1080475264 1 Left 1080475259 11:32584112-32584134 CCGGCGGTCCCAGCGCGGGGCCC 0: 1
1: 0
2: 4
3: 35
4: 321
Right 1080475264 11:32584136-32584158 ACGCTTCACCGCCAGCTCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 131
1080475260_1080475264 -7 Left 1080475260 11:32584120-32584142 CCCAGCGCGGGGCCCGACGCTTC 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1080475264 11:32584136-32584158 ACGCTTCACCGCCAGCTCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 131
1080475261_1080475264 -8 Left 1080475261 11:32584121-32584143 CCAGCGCGGGGCCCGACGCTTCA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1080475264 11:32584136-32584158 ACGCTTCACCGCCAGCTCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080475264 Original CRISPR ACGCTTCACCGCCAGCTCCC TGG Intronic
900379704 1:2377763-2377785 GCTCTTCACCCCCACCTCCCAGG - Intronic
900431662 1:2605737-2605759 AAGCTCCACCACCAGCTCCTGGG - Intronic
901003315 1:6159927-6159949 ATCCTCCACCGCCAGCTCCTGGG - Intronic
902304256 1:15524759-15524781 CCGCGTCACCGCCCACTCCCCGG + Intronic
905289601 1:36912321-36912343 ACGTTTATCCACCAGCTCCCAGG - Intronic
907195015 1:52679381-52679403 GAGCCTCACCGTCAGCTCCCTGG + Intergenic
909034781 1:70584492-70584514 TCGGCTCACCGCAAGCTCCCGGG + Intergenic
909592747 1:77370235-77370257 ACACTTCACCTCCAGCTCCGTGG + Intronic
910494089 1:87806593-87806615 AGGCATCTCCGCCAGCTCCCTGG - Intergenic
912623742 1:111191052-111191074 ACTCTGCAGCTCCAGCTCCCTGG - Intronic
915835375 1:159171742-159171764 GCGCTTCCCGGCCGGCTCCCTGG - Exonic
922739429 1:228007038-228007060 ACGCCGCCGCGCCAGCTCCCAGG + Exonic
1063150454 10:3332030-3332052 ACCCTTCAGCGCCAGCTCTCCGG + Intergenic
1067435413 10:46273187-46273209 AATCTTCACAGCCACCTCCCAGG + Intergenic
1072740980 10:97909245-97909267 AGGCCCCACCTCCAGCTCCCAGG + Intronic
1076015556 10:127024696-127024718 TCGCTTCATCACCAGCACCCGGG - Exonic
1077511080 11:2963464-2963486 AGGCATCACTCCCAGCTCCCAGG + Intronic
1079084447 11:17435286-17435308 AAGCCTCACCCCCAGCCCCCAGG + Intronic
1080475264 11:32584136-32584158 ACGCTTCACCGCCAGCTCCCTGG + Intronic
1082802741 11:57426598-57426620 CCGCTTCTCCACCTGCTCCCGGG - Exonic
1082835797 11:57649392-57649414 TAGCAGCACCGCCAGCTCCCAGG + Exonic
1084274631 11:68045032-68045054 CCGCTTCACGGCCAGCTTCCAGG + Exonic
1084476993 11:69394717-69394739 CTGCTTCCACGCCAGCTCCCAGG - Intergenic
1084860163 11:72012976-72012998 AGTCATCACCTCCAGCTCCCGGG + Exonic
1085126085 11:74003724-74003746 ACTCTTCACCGCTACATCCCAGG + Intronic
1088817883 11:113433811-113433833 AAGCTTCTCCCCCTGCTCCCTGG + Intronic
1095261598 12:40105319-40105341 CCTCTTCACCGCCGGCTCCGCGG - Exonic
1096839258 12:54370617-54370639 AGGCCTCACCGCCAGCTCCCCGG + Exonic
1098309031 12:69129967-69129989 ATGCTTCACTGAGAGCTCCCAGG - Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101466994 12:104958592-104958614 CCACTTCACCGCCTGCTCCAAGG + Intronic
1101740075 12:107493848-107493870 AGGCTTCTCTGCCAGCTCCTAGG - Intronic
1101773772 12:107775517-107775539 GCGCTTGTCTGCCAGCTCCCGGG - Exonic
1102616459 12:114158775-114158797 CAGCTGCACAGCCAGCTCCCAGG + Intergenic
1109630397 13:65037613-65037635 AACCTTCACCCCCATCTCCCAGG + Intergenic
1113017962 13:105849971-105849993 ACACTTCAAATCCAGCTCCCAGG - Intergenic
1114254551 14:20990293-20990315 AGGCCTCATCGCCAGCACCCTGG + Exonic
1114295463 14:21325227-21325249 ACTCTTCTCCACCAGCTCCTGGG - Exonic
1117445238 14:55797980-55798002 ATGCTTCACCGCCAGTTCTCTGG + Intergenic
1120392205 14:83923773-83923795 AGACATCACTGCCAGCTCCCAGG - Intergenic
1121172959 14:91869788-91869810 AGGGTTCCCCGCCAGCTCCCGGG + Intronic
1124499786 15:30217421-30217443 AGGCTTCACAGCCAACACCCAGG - Intergenic
1124743793 15:32321243-32321265 AGGCTTCACAGCCAACACCCAGG + Intergenic
1129966424 15:79739760-79739782 GCACTTCACCTCCTGCTCCCGGG - Intergenic
1130411721 15:83653803-83653825 ACGCTCCTCCGCCCGCTTCCTGG - Intergenic
1131092521 15:89633249-89633271 ATGCTTCAGCTCCAGCTCCTGGG + Exonic
1131453253 15:92563508-92563530 ACTCTTAACCCCCAGCTCCTGGG - Intergenic
1132870597 16:2114134-2114156 AGGCTCCACCACCAGCCCCCAGG - Intronic
1132877084 16:2144726-2144748 ACTCTCCGCCCCCAGCTCCCAGG + Intronic
1133740441 16:8647136-8647158 TCGCTTCTCCCCAAGCTCCCAGG + Exonic
1134521935 16:14922770-14922792 AGGCTCCACCACCAGCCCCCAGG + Intronic
1134709604 16:16321421-16321443 AGGCTCCACCACCAGCCCCCAGG + Intergenic
1134716818 16:16361450-16361472 AGGCTCCACCACCAGCCCCCAGG + Intergenic
1134949998 16:18347224-18347246 AGGCTCCACCACCAGCCCCCAGG - Intergenic
1134957934 16:18390709-18390731 AGGCTCCACCACCAGCCCCCAGG - Intergenic
1136287602 16:29253607-29253629 AGGCTTCACCCCCAGCACGCAGG + Intergenic
1138147841 16:54628087-54628109 ACGCTTCACTCCCAGGTGCCAGG - Intergenic
1138552705 16:57756166-57756188 ATGCTTCACAGCCAGCTCACAGG - Intronic
1140115554 16:72038406-72038428 ACGGCTCACCGCAACCTCCCAGG + Intergenic
1142093225 16:88226235-88226257 AGGCTTCACCCCCAGCACGCAGG + Intergenic
1143928285 17:10392864-10392886 ACCCTTCAGCGCCAGCTGCTCGG + Exonic
1144490135 17:15701219-15701241 GCGCCTCACGGCCAGATCCCAGG + Exonic
1144910828 17:18680740-18680762 GCGCCTCACGGCCAGATCCCAGG - Exonic
1145765883 17:27457757-27457779 ACGTTTCACCGCCCCGTCCCTGG - Intronic
1149995929 17:61405880-61405902 TGGCCTCGCCGCCAGCTCCCTGG - Intronic
1151139280 17:71976133-71976155 TTGCTTCACCCCCAGCCCCCAGG - Intergenic
1152806081 17:82356990-82357012 ACACTTCCCCGTCAGCTTCCCGG + Intergenic
1156463364 18:37333969-37333991 ACAGTGCACAGCCAGCTCCCAGG - Intronic
1157747718 18:50151014-50151036 ACTCTTCAAGGCCAGCTCTCAGG + Intronic
1160477635 18:79207165-79207187 AAGCCTCACCACAAGCTCCCAGG - Intronic
1161156160 19:2732826-2732848 ACTCTTCTCCTCCAGCTCCTTGG + Exonic
1161844200 19:6702501-6702523 ACGTTCCACAGCCAGCTCTCTGG + Exonic
1165443880 19:35846006-35846028 ACACTGCACCGCCAGCTGCGTGG + Exonic
1165925420 19:39323143-39323165 ACCCTTCATCGCCACCACCCAGG + Intergenic
1166631551 19:44411637-44411659 AGTCTTCACCGCCAGCCTCCTGG + Intergenic
1168687540 19:58357748-58357770 ACTCTTCTCCTCCAGGTCCCTGG + Intronic
931241934 2:60461567-60461589 TCTCTCCACCGCCAGCTCCCCGG - Exonic
937362202 2:121237220-121237242 TGGCCTCACCTCCAGCTCCCAGG + Intronic
938199744 2:129362911-129362933 TGGCTTCACCCCCAGCCCCCAGG - Intergenic
940326663 2:152432848-152432870 ACGCTGCAAAGCCAGCTCTCAGG - Intronic
947118958 2:226797799-226797821 GAGCATCACCGCCACCTCCCCGG - Exonic
948617985 2:239213775-239213797 AGCCTTCATCTCCAGCTCCCTGG + Intronic
1169328066 20:4693106-4693128 TGGCATCACCGCCATCTCCCTGG + Intronic
1170044896 20:12074535-12074557 ACTCTCCCCCTCCAGCTCCCAGG - Intergenic
1171333486 20:24361714-24361736 ATGTTTCACAGCCAACTCCCAGG + Intergenic
1175327542 20:58140228-58140250 ACGCTGCACCCTCAGCTCCTGGG + Intergenic
1175873059 20:62217395-62217417 CCCCTGCACCTCCAGCTCCCAGG - Intronic
1177348182 21:19900338-19900360 AGGGTTCAGCGCCAGCTTCCAGG + Intergenic
1179991007 21:44948244-44948266 ATGCTTCACGACCAGCTCCCCGG - Intronic
1179991016 21:44948275-44948297 ATGCTCCACGACCAGCTCCCCGG - Intronic
1179991025 21:44948306-44948328 ATGCTCCACGACCAGCTCCCCGG - Intronic
1179991033 21:44948336-44948358 ATGCTCCACGACCAGCTCCCCGG - Intronic
1180259994 21:46662320-46662342 ACATTTCCCCGCCAGCACCCTGG + Intronic
1180996934 22:19970444-19970466 ACCCTTCCCTGCCACCTCCCTGG + Exonic
1181000705 22:19986746-19986768 ACGCTTCTTGGCCAGCGCCCAGG - Intronic
1181519752 22:23438461-23438483 ACCCTTCGCCCCCAGATCCCAGG + Intergenic
1183492998 22:38126696-38126718 ACCCTGCCCAGCCAGCTCCCAGG + Intronic
950088478 3:10278282-10278304 TTGCTTCACCGGCAGCTACCCGG + Exonic
950105902 3:10388298-10388320 CCTCTTCACCACCAGCCCCCAGG + Exonic
956809292 3:72848591-72848613 CCGGTTCAACGCCGGCTCCCAGG - Intronic
966165060 3:177007927-177007949 ACCCTTTGCCTCCAGCTCCCGGG + Intergenic
968518393 4:1024244-1024266 ACTCTACCCCGCCAGCACCCTGG - Intronic
968520652 4:1033374-1033396 ATGCTTCACCCTCAGCACCCTGG + Intergenic
969309381 4:6344258-6344280 ATTCTTCACCCCCAGCTCCCAGG - Intronic
971945409 4:33268938-33268960 ACACTTAACAGCCAGCTCCATGG - Intergenic
973550601 4:52031954-52031976 ATTCTCCACCTCCAGCTCCCTGG - Intronic
974629296 4:64462655-64462677 TCGGCTCACTGCCAGCTCCCGGG + Intergenic
975556755 4:75673089-75673111 CCGCTACACCTCCGGCTCCCGGG + Intronic
977518908 4:98056346-98056368 CTGCTTCCCCGCCAGCTGCCAGG + Intronic
981224032 4:142270418-142270440 CCTCTTCCCTGCCAGCTCCCTGG - Intronic
981884199 4:149653184-149653206 ACTCTTGACCACCTGCTCCCTGG - Intergenic
985980151 5:3456178-3456200 ACGCTTCACCTCCAGTTCTGTGG + Intergenic
990247676 5:53879373-53879395 TCGGCTCACCGCAAGCTCCCGGG - Intergenic
990347894 5:54887027-54887049 AAGCTTCACCTCCAGCACTCTGG - Intergenic
995462550 5:112419245-112419267 GCGCTTCCCCGGCGGCTCCCGGG - Exonic
1002455356 5:179343166-179343188 CAGCATCACTGCCAGCTCCCTGG + Intronic
1005955851 6:30662920-30662942 AAGCTTCACACCCATCTCCCGGG + Exonic
1011773477 6:90701524-90701546 ACTCTTCACAGGCAGCTGCCTGG - Intergenic
1015955871 6:138597486-138597508 ACGCCTCACTTCCAGGTCCCGGG + Intronic
1018169192 6:161130780-161130802 ACGCTGCAGAGCCAGCTTCCGGG - Exonic
1019591509 7:1837817-1837839 ACCCTTCGCCCCCAGATCCCAGG - Intronic
1021452760 7:20798023-20798045 ACGCGTCCCCGCCTGCTCGCCGG + Intergenic
1023289656 7:38656215-38656237 ACCCTTCATGGCCAGCTCCCCGG - Intergenic
1023418186 7:39950973-39950995 ACGCTTCTCCGCCTCCTGCCCGG - Exonic
1024307290 7:47939543-47939565 ACGCTTCTCCTCCATCTCCAGGG + Intronic
1024993531 7:55254542-55254564 CCGCTCCACCTCCCGCTCCCGGG + Intronic
1033289534 7:140071620-140071642 ACCCTCCACCGGCAGTTCCCTGG + Intergenic
1033406247 7:141073511-141073533 ACCTTTCCCCGCGAGCTCCCCGG - Intergenic
1035143583 7:156788970-156788992 TCGCTGCACCTCCATCTCCCGGG - Intronic
1035297345 7:157874587-157874609 TCGCTCCACAGACAGCTCCCGGG + Intronic
1035820786 8:2589440-2589462 AGAGTTCACCACCAGCTCCCTGG + Intergenic
1037787436 8:21911242-21911264 AAGCTTCACCCCCAGGGCCCCGG - Intronic
1038296168 8:26292070-26292092 ACGCCTCACCCCAAGCTCGCCGG - Intronic
1049744896 8:144259133-144259155 CCGCTCCACCGCCAGCTGCCAGG - Intronic
1060819592 9:126653749-126653771 ACCCTTCATCCCCAGCCCCCTGG + Intronic
1060863391 9:126974896-126974918 ACACTTCATAGCCAGCTCTCGGG - Intronic
1061211463 9:129195845-129195867 CTGCTTCACCTCCAGCTCTCAGG + Intergenic
1061369656 9:130191307-130191329 AACCTTCAGCCCCAGCTCCCGGG - Intronic
1061431916 9:130536537-130536559 AGGATTCTCTGCCAGCTCCCTGG + Intergenic
1062382216 9:136291919-136291941 AGGCTCCATCGCCAGTTCCCGGG - Intronic
1187396605 X:18924707-18924729 ACCCTACAGCGACAGCTCCCGGG - Intronic
1189310587 X:40014749-40014771 AAGCTTCCACGCCAGCTCACCGG - Intergenic
1199848793 X:151710727-151710749 ACTCTTTCCCACCAGCTCCCAGG + Intergenic
1200124616 X:153807414-153807436 ACACCTCAGCCCCAGCTCCCAGG + Intronic
1200224522 X:154409770-154409792 ACGTTGGACTGCCAGCTCCCTGG - Intronic