ID: 1080480649

View in Genome Browser
Species Human (GRCh38)
Location 11:32646250-32646272
Sequence CTCTGTCAGCTATACAAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080480647_1080480649 5 Left 1080480647 11:32646222-32646244 CCTTTCATTACAATTTTGACCTA 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1080480649 11:32646250-32646272 CTCTGTCAGCTATACAAATTAGG 0: 1
1: 0
2: 0
3: 11
4: 133
1080480646_1080480649 9 Left 1080480646 11:32646218-32646240 CCATCCTTTCATTACAATTTTGA 0: 1
1: 1
2: 5
3: 34
4: 430
Right 1080480649 11:32646250-32646272 CTCTGTCAGCTATACAAATTAGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080480649 Original CRISPR CTCTGTCAGCTATACAAATT AGG Intronic
903784058 1:25845449-25845471 CTCTGTGAGGCATACAAATGAGG - Intronic
908500846 1:64742795-64742817 GTCTCTCAGCTCTACAAAATAGG + Intergenic
908596650 1:65695421-65695443 GTCTGTCAGCCATACATAGTGGG + Intergenic
909746734 1:79107142-79107164 CTCTGTTATCTATAGAAATATGG + Intergenic
910094848 1:83509895-83509917 CTCTTTCAACTATACCACTTAGG - Intergenic
911741943 1:101395687-101395709 CTCTCTCAGATGTACATATTGGG + Intergenic
916344338 1:163771134-163771156 CTCTGTCAGCTTAACAGATGTGG + Intergenic
916599355 1:166276825-166276847 CTCTGTTAGCTATACTGACTTGG + Intergenic
918799194 1:188950104-188950126 ATATTTTAGCTATACAAATTTGG - Intergenic
922782220 1:228262234-228262256 CTCTGTCTGCTATACAATGTTGG - Intronic
1063206463 10:3836251-3836273 CACTATAATCTATACAAATTGGG - Intergenic
1066455846 10:35571072-35571094 CTTTTTCAGCTATATAGATTAGG - Exonic
1066591546 10:37000421-37000443 ATCTGTCAGCTATTCAACTTGGG - Intergenic
1068615104 10:59105753-59105775 CTGTTTCAGGTATACAAAATAGG + Intergenic
1071973490 10:90931515-90931537 CTCTGGCATTTATACAAATGAGG + Intergenic
1074344407 10:112668782-112668804 TTCTGACAGCTACACAAACTTGG - Intronic
1076349193 10:129803291-129803313 CTCTGTCAGTTCTACATGTTAGG + Intergenic
1079867419 11:25754530-25754552 CTCATTAAGCTAGACAAATTTGG + Intergenic
1080310350 11:30883152-30883174 CACTAGCAGCTATACAACTTTGG - Intronic
1080480649 11:32646250-32646272 CTCTGTCAGCTATACAAATTAGG + Intronic
1082057122 11:47827465-47827487 CTCCCTTAGCAATACAAATTAGG + Intronic
1085896746 11:80648852-80648874 ATCTGTCAGCTATTCAACTTGGG + Intergenic
1091863206 12:3805584-3805606 CCCTGTAAGTTAAACAAATTAGG - Intronic
1093661595 12:21763720-21763742 CTGTGTCACCTCTACAAAGTTGG + Intergenic
1098700475 12:73618105-73618127 CTCTCTCATTTATAAAAATTAGG - Intergenic
1099618723 12:84974314-84974336 CTTTGTCAGCTTTAAAAACTTGG - Intergenic
1099711852 12:86236905-86236927 CTTTACCAGGTATACAAATTTGG - Intronic
1100866240 12:98860291-98860313 CTGTGTCAGCTCTTCAAACTGGG + Intronic
1101896622 12:108761913-108761935 CTCTGTCACCTACACCGATTAGG + Intergenic
1102085764 12:110138098-110138120 CTCTATCAGCTATTTACATTGGG - Intronic
1108367415 13:49729881-49729903 CTATCTCATCTATAAAAATTAGG - Intronic
1108996297 13:56738082-56738104 CTCTGTTAGCAATACTACTTAGG - Intergenic
1111930998 13:94513198-94513220 CTCTGTCAGAGATAAAAATAAGG + Intergenic
1112918752 13:104583671-104583693 CTCTGTCAGGTGGAGAAATTTGG + Intergenic
1113577628 13:111405257-111405279 TTCTGTCAGCTATACACTCTGGG - Intergenic
1118547971 14:66915844-66915866 CACTGCTTGCTATACAAATTAGG - Intronic
1120361724 14:83513078-83513100 CTTTGTCAGCTATACATTTCAGG - Intergenic
1130626182 15:85517810-85517832 ATCTGTCAGCAAAACTAATTAGG + Intronic
1133537470 16:6715783-6715805 CCCTTTCAGCTACACAAAATTGG + Intronic
1140966765 16:79973978-79974000 CTTGGTCAGCTATACAGATCTGG - Intergenic
1144527857 17:16005910-16005932 CTATGTCAGTTATTAAAATTAGG + Intronic
1149099731 17:52889919-52889941 CTCAGTCTACTATAGAAATTGGG - Intronic
1151055678 17:71028244-71028266 CTCTGTCATCTATAGGTATTTGG - Intergenic
1159520495 18:69514681-69514703 ATCTTTCATCTAAACAAATTTGG + Intronic
1159532827 18:69677075-69677097 CTTTGTAAACAATACAAATTAGG - Intronic
1159837412 18:73355309-73355331 TTCTGTCTGATATAAAAATTTGG + Intergenic
1159939567 18:74396477-74396499 CTCTGGCACCTGTAGAAATTAGG + Intergenic
1160358838 18:78252475-78252497 CTCTTTCTGCTACACAAACTTGG - Intergenic
926132590 2:10313726-10313748 CTCTGTCAGCTCTGCAATTCAGG + Intronic
926987421 2:18639748-18639770 CTCTGTCAGCTGTAGAACGTGGG + Intergenic
934810110 2:97270385-97270407 CTCTGTCAGCTCTAGAACTAAGG + Intergenic
934827582 2:97437554-97437576 CTCTGTCAGCTCTAGAACTAAGG - Intergenic
937599237 2:123709886-123709908 CTCTGTCCCCTCTAGAAATTGGG + Intergenic
937997329 2:127704497-127704519 CTCTTTAAGCTATACCAGTTGGG + Exonic
940052377 2:149478296-149478318 TTCTGTCAACTAAACAAATAGGG + Intergenic
941093144 2:161202098-161202120 CTTTGTCAGTTATTCATATTTGG + Intronic
943458888 2:188144270-188144292 CACTCCCAGCTATATAAATTTGG + Intergenic
944578787 2:201114570-201114592 CTCTGTCAGTTATCCAAGTTTGG - Intergenic
945620882 2:212135607-212135629 TTCTGTCATCTATACATACTTGG + Intronic
946181584 2:217952267-217952289 CTCTCTCAACTGTACAAAGTAGG - Intronic
946210578 2:218144100-218144122 CACTCTCAGCCATACAGATTTGG - Intergenic
946544488 2:220722823-220722845 CTTTGTCAGATATATAGATTGGG + Intergenic
946741310 2:222804777-222804799 GTCTGTCAGCTATGATAATTTGG + Intergenic
1170466687 20:16628706-16628728 CTCTCTCAGCTTTCCAATTTTGG + Intergenic
1171415978 20:24980679-24980701 CTCTGTCACCTCTACACACTGGG + Intronic
1176012212 20:62904054-62904076 CTCTGGCAGCTTTTCAATTTTGG + Intronic
1177026706 21:15929702-15929724 CTCTTTCAGCTACACAGTTTAGG - Intergenic
1177495625 21:21887075-21887097 CTCTCTCAGTTTTACAAATTTGG - Intergenic
1177652625 21:23978370-23978392 CTTTTTCAGCTATACTAGTTGGG - Intergenic
1177786043 21:25672638-25672660 CTTTGAGAGCTATATAAATTAGG - Intronic
1180829019 22:18888371-18888393 GTCTGTGAGCTACACAAACTGGG - Intergenic
1203279110 22_KI270734v1_random:114359-114381 GTCTGTGAGCTACACAAACTGGG - Intergenic
949115392 3:315239-315261 CTCACTCAGCTGTACAAACTGGG - Intronic
950697817 3:14717160-14717182 CTGTCTCATCTATACAAAGTGGG + Intronic
951200990 3:19875420-19875442 CTCTCTCAGCCTTACAAACTTGG + Intergenic
955312278 3:57901098-57901120 CTCTATCAGTTATACCTATTTGG + Intronic
957856120 3:85881100-85881122 TTCTCTCAGCTATTCAGATTGGG + Intronic
962359411 3:134725322-134725344 CTCTGAAACCTATACAATTTGGG - Intronic
963312805 3:143727288-143727310 CTCTGCCAGCCATAAAATTTTGG + Intronic
963312839 3:143727622-143727644 CTCTGCCAGCCATAAAACTTTGG - Intronic
970333913 4:15012084-15012106 CTTTATCAGATAAACAAATTGGG - Intronic
971513838 4:27462383-27462405 AGCTGTAAACTATACAAATTTGG - Intergenic
971830573 4:31687255-31687277 TTATGTCAGTTATACAAAATAGG + Intergenic
974249190 4:59362726-59362748 CTCTGTCAGCTAGAGAACATTGG + Intergenic
974991033 4:69090984-69091006 CTCTGTGATCCATACACATTGGG + Intronic
977413875 4:96704217-96704239 CTCTGGCATATTTACAAATTTGG + Intergenic
978544907 4:109860465-109860487 CTCTGCCAGCTATAGAAAGAGGG - Intronic
978635620 4:110802164-110802186 CAATGTCTGCTATACTAATTAGG + Intergenic
981092875 4:140750885-140750907 ATGTGGAAGCTATACAAATTCGG + Intronic
983207098 4:164921935-164921957 TTTAGTCAGCTACACAAATTTGG + Intergenic
987139409 5:14929980-14930002 CTCTGTCAGCTATAGATCTTGGG - Intergenic
987770782 5:22301345-22301367 CTCTGTGAGCTATATTAGTTTGG - Intronic
988328036 5:29796578-29796600 CTCTGTTTTCTATACAAATCAGG + Intergenic
990486427 5:56263511-56263533 CTCTGGCATGCATACAAATTAGG - Intergenic
990645625 5:57840877-57840899 CTCTGTCAAATATTCAAATATGG + Intergenic
991483877 5:67113478-67113500 CTCTGTCTCCTATAAAACTTTGG - Intronic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
997015487 5:129929428-129929450 TTCTTTCAGCTATACTATTTAGG + Intronic
998615023 5:143730575-143730597 CTGTGCCAGCTATACCAACTTGG + Intergenic
999069620 5:148730153-148730175 CTCTGTTAGTAATACAAATTGGG - Intergenic
999795909 5:154989677-154989699 TTCTCTCAGATATACAAGTTTGG + Intergenic
1000921324 5:167141474-167141496 CTCTGTCAACTTTAAGAATTTGG + Intergenic
1001434043 5:171685711-171685733 CTCTGTCAGCGAAACAGATAGGG - Intergenic
1003716868 6:8656858-8656880 CTCTGTAAGCTCTACAAAATGGG - Intergenic
1007792460 6:44319072-44319094 CTCTGTCCTCTATAAAAATCTGG - Intronic
1008972129 6:57380926-57380948 CTCTCTCAGCTTTACAGATCTGG + Intronic
1009026427 6:58005914-58005936 CAGTTTCAACTATACAAATTAGG + Intergenic
1009161043 6:60282458-60282480 CTCTCTCAGCTTTACAGATCTGG + Intergenic
1009201977 6:60757387-60757409 CAATTTCAACTATACAAATTAGG + Intergenic
1009696534 6:67112267-67112289 CTCTGTCAGGAAAACGAATTAGG + Intergenic
1009795212 6:68457441-68457463 CTTTGTCAGATATACATACTTGG + Intergenic
1013022229 6:106231697-106231719 CTCAGTCAGCTACAGACATTAGG + Intronic
1014171707 6:118286183-118286205 TTCTTTCAGCTATCCAAGTTTGG - Intronic
1015307057 6:131721241-131721263 CGCTGTTAGCTTTAGAAATTTGG + Intronic
1016806609 6:148218360-148218382 CTCTGTCATCTTTACATGTTAGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1021521002 7:21538803-21538825 CTCTGTCGGCTATAGAACATGGG + Intergenic
1021585194 7:22200153-22200175 CTGTGTCTGTTATACAAATGTGG + Intronic
1022868971 7:34456300-34456322 CAATGTCTGCTATAAAAATTGGG + Intergenic
1028703586 7:93812626-93812648 CTCTGGAAGCTGTTCAAATTGGG + Intronic
1031862175 7:126993546-126993568 CTCTGTCAGCAATATAAACCAGG - Intronic
1037303748 8:17482628-17482650 TTGTGTCAGCTAGCCAAATTGGG + Intergenic
1038551678 8:28475051-28475073 CTCTGTCAGCTTTCAAAATTGGG + Intronic
1041234930 8:55791030-55791052 CTTTTTCAGCAATACAAATCTGG - Intronic
1041972593 8:63760751-63760773 CTCTGTCTGCTATAGAACATGGG + Intergenic
1042662880 8:71175238-71175260 CTCTCTCAGCTTTAAAAATGAGG - Intergenic
1049920566 9:359881-359903 CTCTTTCAGCCAAACAATTTTGG - Intronic
1050129048 9:2390461-2390483 TTCTGCCAGCTATAAAAATTGGG + Intergenic
1051811970 9:21059399-21059421 CTCCCTCAGATATATAAATTTGG - Intergenic
1052311761 9:27075682-27075704 CTCTGTCAGCTAGAAAGCTTGGG + Intergenic
1056930222 9:90868859-90868881 CTTTGTCAATTATACAATTTTGG - Intronic
1060776346 9:126377526-126377548 CCCTGTCAGCTACCCAAATAAGG - Intronic
1185585716 X:1240898-1240920 CTCTGTGAGCGATAGAGATTTGG + Intergenic
1186880290 X:13858565-13858587 GTCTGTCAGCTTCACAAATAAGG - Intronic
1187051419 X:15700093-15700115 CACTGTGAGCAATACAATTTTGG - Intronic
1187118060 X:16373736-16373758 CTCTGTCAGCTACATAAAAAGGG + Intergenic
1189630560 X:42948102-42948124 CTCTGTGACCAATACAAAGTAGG + Intergenic
1195520943 X:105827859-105827881 CTATGACTGCTATACCAATTTGG - Intronic
1197452044 X:126630653-126630675 CTTTGTCCGTTATTCAAATTAGG + Intergenic
1197583822 X:128318752-128318774 CTCTCTCAGATATTGAAATTGGG + Intergenic
1198398397 X:136245968-136245990 CTCTATCATATAAACAAATTAGG + Intronic
1199149771 X:144416875-144416897 CTTTGGCAGAAATACAAATTAGG - Intergenic
1200327890 X:155261569-155261591 CTCTGTCAGTTATTCAGATTTGG - Intronic
1201327987 Y:12786311-12786333 CTCTGTTAGGTATAGAACTTGGG - Exonic