ID: 1080483278

View in Genome Browser
Species Human (GRCh38)
Location 11:32675483-32675505
Sequence CGCTATTACTAGAGGACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080483278 Original CRISPR CGCTATTACTAGAGGACAGT TGG (reversed) Intronic
911838280 1:102649120-102649142 CACTATGAATAAAGGACAGTAGG + Intergenic
916462176 1:165036783-165036805 CCCTATTTCTAGCGGTCAGTGGG + Intergenic
919170667 1:193949603-193949625 CGATAGTAAGAGAGGACAGTGGG + Intergenic
1068545645 10:58342263-58342285 CCATATGAATAGAGGACAGTGGG - Intronic
1074902681 10:117832653-117832675 AGCCATTTCTAGATGACAGTTGG - Intergenic
1076436380 10:130446748-130446770 CTATATTACTAGAGGAAATTTGG - Intergenic
1078499934 11:11861706-11861728 CCCTAATACTAGAGCACAGAGGG + Intronic
1080483278 11:32675483-32675505 CGCTATTACTAGAGGACAGTTGG - Intronic
1087417019 11:97870301-97870323 CACTTTTACTAAAGGACAATAGG - Intergenic
1104760527 12:131295312-131295334 GGCTCTGACTAGGGGACAGTGGG - Intergenic
1104819248 12:131665473-131665495 GGCTCTGACTAGGGGACAGTGGG + Intergenic
1107320364 13:39179898-39179920 TGCTATTACAAGAGGAGAGAAGG - Intergenic
1112653365 13:101422182-101422204 TGCTATTTCTAGAGCACAGGGGG + Intergenic
1129962004 15:79695391-79695413 TGCTATTTCTGGAAGACAGTAGG - Intergenic
1132394956 15:101465529-101465551 GGCTATTAGAAGAGGACAGAGGG + Intronic
1135210033 16:20517594-20517616 TTCTATTTTTAGAGGACAGTGGG - Intergenic
1137380768 16:47997439-47997461 GGCTATTACCAGAGCACAGAAGG + Intergenic
1143125076 17:4636727-4636749 GGCAATTCCTAGGGGACAGTTGG - Intronic
1151080456 17:71323442-71323464 CGTTATAAGAAGAGGACAGTGGG + Intergenic
1156759241 18:40567458-40567480 AACAATTACTAGAGGAAAGTAGG + Intergenic
1157213264 18:45761784-45761806 CGCTGTTACTAGAAGAAGGTGGG - Intergenic
938461105 2:131497450-131497472 CGTTATTACTACAGGACCTTGGG + Intergenic
938970383 2:136425886-136425908 TGCCATTTGTAGAGGACAGTGGG + Intergenic
946625543 2:221608662-221608684 CTCTATTACTGGTGGACATTTGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
949113397 3:290631-290653 CCCTGTTCCTAGAGTACAGTAGG + Intronic
956452932 3:69392210-69392232 AGCGAGTCCTAGAGGACAGTGGG + Intronic
973297983 4:48547937-48547959 CCCTAGTACTATAAGACAGTAGG - Intronic
984513647 4:180710927-180710949 CTCTATTTCTAGAGCACAGATGG + Intergenic
990138364 5:52674749-52674771 GGTTATTATTAAAGGACAGTAGG - Intergenic
1008003362 6:46384155-46384177 CCCTAATACTAAAGGAGAGTGGG - Intronic
1015454016 6:133404605-133404627 CTCTATGACTAGAAGACTGTGGG - Intronic
1018343396 6:162876319-162876341 CTGTATTATTAGAGGACAGCAGG - Intronic
1022984915 7:35643100-35643122 CTCTATTATTAGAGGACAGCAGG - Intronic
1042726599 8:71885743-71885765 CACCATTACTAGAGGAAAATAGG - Intronic
1047705664 8:127497064-127497086 CTTTATTATTAGAGGAGAGTAGG + Intergenic
1057124692 9:92607821-92607843 AGCTATTACAACAGCACAGTGGG + Intronic
1057710715 9:97440633-97440655 AGCTATTCCTTGAGGACACTTGG - Intronic
1201549070 Y:15199893-15199915 CTCCATTACTTGAGGACACTGGG + Intergenic