ID: 1080485797

View in Genome Browser
Species Human (GRCh38)
Location 11:32705125-32705147
Sequence CGGGAAACAGCAGTGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 371}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080485785_1080485797 15 Left 1080485785 11:32705087-32705109 CCCAGCCTCTGCCAGTGCTGGGT 0: 1
1: 1
2: 1
3: 52
4: 501
Right 1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG 0: 1
1: 0
2: 5
3: 28
4: 371
1080485786_1080485797 14 Left 1080485786 11:32705088-32705110 CCAGCCTCTGCCAGTGCTGGGTG 0: 1
1: 2
2: 3
3: 56
4: 508
Right 1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG 0: 1
1: 0
2: 5
3: 28
4: 371
1080485789_1080485797 4 Left 1080485789 11:32705098-32705120 CCAGTGCTGGGTGGCCGCACCAT 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG 0: 1
1: 0
2: 5
3: 28
4: 371
1080485792_1080485797 -10 Left 1080485792 11:32705112-32705134 CCGCACCATTCAACGGGAAACAG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG 0: 1
1: 0
2: 5
3: 28
4: 371
1080485788_1080485797 10 Left 1080485788 11:32705092-32705114 CCTCTGCCAGTGCTGGGTGGCCG 0: 1
1: 1
2: 6
3: 25
4: 246
Right 1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG 0: 1
1: 0
2: 5
3: 28
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080485797 Original CRISPR CGGGAAACAGCAGTGGGGCT AGG Intronic
900615948 1:3565714-3565736 TGGGAAACTGCAGTGGGCTTTGG - Intronic
900783866 1:4635264-4635286 CTGAAAACAGCAGTGGGACCAGG + Intergenic
901195276 1:7436771-7436793 CTGGGAACGGCAGTGGGGCTGGG + Intronic
901728582 1:11261970-11261992 GGGGAAACAGGGATGGGGCTGGG + Intronic
901914324 1:12486514-12486536 AGGAAAAGAACAGTGGGGCTTGG - Intronic
902074778 1:13775615-13775637 TGGGAAACAGCAAGGAGGCTAGG + Intronic
902535813 1:17118870-17118892 TGGGAAGCAGGAGAGGGGCTGGG + Intronic
902640621 1:17764070-17764092 CGGGAAACCCCGGTGGGGGTGGG + Intronic
902832947 1:19029481-19029503 TGGGAAACGACAGTGGGGCAGGG - Intergenic
903379613 1:22887523-22887545 TGGGAAATCCCAGTGGGGCTTGG - Intronic
904288535 1:29469289-29469311 AGGGTCACGGCAGTGGGGCTGGG + Intergenic
904430469 1:30461000-30461022 CAGGAAGCAGCAGTGGTCCTGGG + Intergenic
905033994 1:34905234-34905256 CGGGGCACAGAAGCGGGGCTCGG + Exonic
905890218 1:41514099-41514121 TGGAAGACAGCAGTAGGGCTGGG + Intronic
907093680 1:51754057-51754079 TGGGAGACTGCAGTGGAGCTGGG + Intronic
907179006 1:52553346-52553368 GGGGAAACAGCACTGGGGGGAGG + Intronic
907248347 1:53122004-53122026 CGGGGAGCAGCTGGGGGGCTGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908127119 1:61043144-61043166 CGGGTAAAAGCAGTGGCGCTGGG + Intronic
908585669 1:65564740-65564762 CGGTAATCAGCTGTGGGACTTGG - Intronic
909054523 1:70806237-70806259 CGGGAAGCAGCAGCAGGGCTAGG - Intergenic
911935080 1:103960188-103960210 TGGGAAGCAGCAGCGGGGCCAGG - Intergenic
912978884 1:114352967-114352989 CAGCGAACAGCAGTGTGGCTGGG + Intergenic
913233797 1:116763433-116763455 AGAAAAGCAGCAGTGGGGCTCGG - Intronic
915171593 1:153982007-153982029 GGAGAAATAGCAGAGGGGCTTGG - Exonic
915475664 1:156151337-156151359 GGGGAGATGGCAGTGGGGCTTGG + Intronic
915630684 1:157152045-157152067 GGGGAGCCAGTAGTGGGGCTGGG - Intergenic
919954858 1:202403600-202403622 CAGGGAACAGCTGTGAGGCTGGG + Intronic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920583738 1:207137472-207137494 GGGGAAGGAGGAGTGGGGCTGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924602629 1:245504733-245504755 AGGGAAAGAGCAGAGAGGCTGGG - Intronic
924652258 1:245940138-245940160 CGGGACACAGCACTGGGGGGAGG + Intronic
924927112 1:248693744-248693766 TGAGAAAAATCAGTGGGGCTGGG - Intergenic
1062834995 10:629576-629598 CGGGTTAAAGCAGTGAGGCTGGG - Intronic
1063423116 10:5929632-5929654 CGCACTACAGCAGTGGGGCTGGG - Intronic
1067203964 10:44198017-44198039 CAGGATGCAGCAATGGGGCTAGG + Intergenic
1067258616 10:44666716-44666738 CAGGAAGTAGCAGTGGGGCCAGG - Intergenic
1067426873 10:46217254-46217276 TGGGCAACAGCGGTGGGGCAAGG + Intergenic
1067457286 10:46428021-46428043 CTGGGAACACCAGTGGGGATGGG + Intergenic
1068065136 10:52121023-52121045 AGGGCAAAAGCAGTGGGCCTTGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069198301 10:65581741-65581763 CAAGAAGCAGCAGTGGGGCTGGG + Intergenic
1070122822 10:73595214-73595236 AAGAAAACACCAGTGGGGCTTGG - Intronic
1070519349 10:77238307-77238329 GGTGCAACAGCAGTGGGTCTCGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072687469 10:97546945-97546967 CGGGAAACAGCTGTCGGGTCTGG + Intronic
1072804278 10:98414902-98414924 GAGGAGAGAGCAGTGGGGCTTGG + Intronic
1072804571 10:98416517-98416539 CAGGGAACAGCTTTGGGGCTGGG - Exonic
1073205842 10:101768911-101768933 CAGGAAACTGCCGTGGGGCCTGG + Intergenic
1073224097 10:101901739-101901761 TGGGAGAAAGCAGGGGGGCTGGG + Intronic
1073792540 10:106955010-106955032 CGGGAAGTAGCAGTGGCGCTGGG + Intronic
1073890711 10:108097316-108097338 GTGGCAACAGCACTGGGGCTTGG + Intergenic
1074360725 10:112822401-112822423 CGAGAAAGAGCAGGGAGGCTGGG + Intergenic
1074738856 10:116464891-116464913 CAGGAAGCTGCAGTGGGGCTGGG - Intronic
1074852000 10:117446476-117446498 CAGGAAACAGCAGAGAGCCTTGG - Intergenic
1074979527 10:118608574-118608596 AAGGAAGCAGCAGTGGGGCTGGG - Intergenic
1075717549 10:124565847-124565869 CGGGTTACAGCAGTGGGGACAGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077585369 11:3447519-3447541 AGGGAAACAACAGTGGGTCCAGG + Intergenic
1077603865 11:3593752-3593774 GGAGAAACAACAGTGGGCCTAGG + Intergenic
1078758601 11:14234053-14234075 CAAGAAACAGCACTGGGGGTCGG - Intronic
1078869872 11:15333448-15333470 TGGGAAACAGCAGCTGGGGTGGG - Intergenic
1079674127 11:23203249-23203271 TGGGAAGCAACAGTGGGGCCAGG + Intergenic
1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG + Intronic
1081286263 11:41274095-41274117 CAGGAAATAGCAGGGAGGCTGGG + Intronic
1083292195 11:61696429-61696451 CGGGGAGGAGCAGTGGGGCCGGG + Intronic
1083589155 11:63882763-63882785 CAGTATACAGCAGTGGAGCTAGG + Intronic
1084242275 11:67830078-67830100 AGGGAAACAACAGTGGGTCCAGG + Intergenic
1084527747 11:69707299-69707321 CAGGAACCAGCTGTGGGGCGTGG - Intergenic
1084565547 11:69926471-69926493 CCTGAAACAGCCCTGGGGCTGGG - Intergenic
1084732318 11:71081589-71081611 CGGGGAACAGGAGAGGGGATGGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1087163385 11:94973429-94973451 CGGGAAAGGGCAGTTGGGGTCGG - Intronic
1088286854 11:108198994-108199016 CAGGAAGCAGGAGTGGGGCTGGG + Intronic
1088555687 11:111058567-111058589 CAGGAAACTGCAGAGGGGCAGGG + Intergenic
1088870369 11:113885480-113885502 CAGAAAACAGAAGTGAGGCTGGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089303393 11:117512239-117512261 CGGGCAGCAGCAGTGGGGTCTGG + Intronic
1091411534 12:243478-243500 CAAGAAACAGCAGTGAGGATGGG - Intronic
1091749574 12:3014077-3014099 CAGGCCACAGCTGTGGGGCTTGG - Intronic
1092091288 12:5805656-5805678 CAGGAAACAGAGATGGGGCTCGG - Intronic
1093835946 12:23828933-23828955 CGTGAAGGAGCAGTGAGGCTAGG - Intronic
1094037989 12:26090980-26091002 CTGGCAACAGCACTGGTGCTAGG + Intergenic
1096179689 12:49543876-49543898 TGGGAGTCAGCACTGGGGCTGGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096658113 12:53104254-53104276 CAGGAAGCAGGAGTGAGGCTTGG + Intronic
1097015080 12:55980330-55980352 GGAGAAATAGCAGAGGGGCTTGG - Intronic
1099992751 12:89743271-89743293 CTGGGAAAAGCAGTGGGGCTTGG + Intergenic
1101500296 12:105298140-105298162 CCAGAAAGAGCAGTGGGGATAGG + Intronic
1101740347 12:107495350-107495372 AGGCAGGCAGCAGTGGGGCTTGG + Intronic
1102540852 12:113618061-113618083 CAGGAGACAGCAATGGGGCAGGG + Intergenic
1102660534 12:114523650-114523672 AGGGAAACAGAAGTGGTTCTGGG + Intergenic
1102676863 12:114665214-114665236 CGGGAAACCGAAGTGGCGCGGGG + Intergenic
1103009702 12:117448606-117448628 TGGGAAGCAGCATTGGGACTTGG - Intronic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103340911 12:120220758-120220780 TGGGAGACAGGAGTGTGGCTGGG - Intronic
1104069339 12:125330962-125330984 TGGAAAGCAGCAGTGGGCCTTGG + Intronic
1106986798 13:35363015-35363037 AGGGAAACAGGAGTGGGACCAGG - Intronic
1108051162 13:46440592-46440614 CAGAAAGTAGCAGTGGGGCTGGG - Intergenic
1109034689 13:57241477-57241499 CAGCAAACAACAGTGTGGCTAGG - Intergenic
1109543719 13:63814212-63814234 CAGAAAGTAGCAGTGGGGCTGGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110364121 13:74662206-74662228 GGGGACCCAGCAGAGGGGCTTGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1111213284 13:85108777-85108799 TGGGAAGCTGCAGTGAGGCTGGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112968962 13:105235217-105235239 CTGGCAACAGCAGAAGGGCTGGG + Intergenic
1113351758 13:109536240-109536262 GGTTAAACAGCACTGGGGCTTGG + Intergenic
1113382153 13:109813860-109813882 TGGGAATGAGCAGTGGGGCCAGG + Intergenic
1113933603 13:113981607-113981629 CGGGAGATTGCAGTGGGGGTGGG - Intronic
1114479366 14:23022620-23022642 CGCAAAACAGCAGAGGTGCTTGG + Intronic
1116019380 14:39442013-39442035 TGGGAAGCAGCAGTGGGGCTGGG + Intergenic
1117254437 14:53963661-53963683 CGGGAGCCAGCTGTGGGGCGCGG - Intergenic
1117828395 14:59726931-59726953 TGAGAAACAGCAGTGGGGGCGGG + Exonic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1121405582 14:93717490-93717512 CAGGAAACAGGGATGGGGCTGGG - Intergenic
1122234528 14:100324143-100324165 CTGGAAACAGCATGGGGGTTGGG + Intronic
1122601843 14:102925449-102925471 CGGGAAACAGGAGGAGGGCAGGG + Intronic
1123538371 15:21261729-21261751 CGGGAAACCACAGTGGGTGTGGG + Intergenic
1123881288 15:24679003-24679025 GGGAAAACAGAAGTGGTGCTGGG - Exonic
1124690151 15:31815106-31815128 CTGGAAGCAGCAGAAGGGCTGGG - Intronic
1127341269 15:58046840-58046862 CTAGAAAAAGTAGTGGGGCTGGG + Intronic
1127509218 15:59623706-59623728 CTGGAAAAAACATTGGGGCTAGG + Intronic
1127581972 15:60346891-60346913 CTGGAGAGAGCAGTGGGGCAGGG - Intergenic
1127914141 15:63441676-63441698 CAGGACACAACAGTGGGGCCTGG + Intergenic
1128072178 15:64804644-64804666 TGGGACACACCCGTGGGGCTTGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129890611 15:79069351-79069373 AGAGATACAGCAGTGTGGCTGGG - Intronic
1131257760 15:90872874-90872896 TGGGAAACAGCAGTCGGTCCTGG + Exonic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132769513 16:1553475-1553497 GGAGGGACAGCAGTGGGGCTCGG + Intronic
1133539138 16:6731788-6731810 TAGGAAACAGCAGTGGGGAAGGG - Intronic
1134410602 16:14000484-14000506 TTGGGAAAAGCAGTGGGGCTTGG + Intergenic
1135645090 16:24154829-24154851 CTGGAAGCAGGAGTGGAGCTGGG - Exonic
1138605593 16:58086312-58086334 AGGGAAATGGCGGTGGGGCTTGG + Intergenic
1139355206 16:66363494-66363516 CTGGAAACAGAAGCGTGGCTCGG + Intergenic
1141418817 16:83898833-83898855 CGGGAAAGAGAGGAGGGGCTGGG + Intergenic
1141775341 16:86119188-86119210 CCTGAAACAGCAGTTGGGCAGGG - Intergenic
1141938899 16:87261236-87261258 CACGGACCAGCAGTGGGGCTGGG + Intronic
1142189773 16:88712520-88712542 CGGGAGACGGCAGTGAGGCTGGG - Intronic
1142218033 16:88839420-88839442 CCGAAAGCAGCAGTGGGGCCTGG + Intronic
1142535891 17:617555-617577 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142535914 17:617655-617677 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142535937 17:617755-617777 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142535949 17:617805-617827 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142535961 17:617855-617877 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142535973 17:617905-617927 CGGGAAACATTAGTGGGGCGTGG - Intronic
1142535985 17:617955-617977 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142535997 17:618005-618027 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142536009 17:618055-618077 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142536021 17:618105-618127 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142536033 17:618155-618177 CGGGAAACATTAGTGGGGCGTGG - Intronic
1142536045 17:618205-618227 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142536080 17:618354-618376 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142536092 17:618404-618426 CGGGAAATATTAGTGGGGCGTGG - Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1145823100 17:27855538-27855560 AGGGAGGCTGCAGTGGGGCTGGG + Intronic
1146663198 17:34678860-34678882 AGAGAAAGAGCACTGGGGCTGGG - Intergenic
1146967012 17:37040601-37040623 TTGGCAACAGCAGTGGGGGTTGG - Intronic
1147522706 17:41189885-41189907 AGGGGAACAGCAGTGGGTCATGG - Exonic
1147530416 17:41271309-41271331 AGGGGAACAGCAGTGGGTCATGG - Intergenic
1147582490 17:41635219-41635241 CAGGAAGCAGAGGTGGGGCTGGG + Intergenic
1147637754 17:41974325-41974347 AGGCAAAAGGCAGTGGGGCTGGG + Exonic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150483744 17:65530359-65530381 CAGGAGACAGCAGAGGTGCTGGG - Intronic
1151940309 17:77287841-77287863 CAGGAAACAGGAGTGGCGCAGGG + Intronic
1152020607 17:77778506-77778528 CAGCAAACAGCAGAGAGGCTGGG - Intergenic
1152630634 17:81409332-81409354 TGGGAGACAGAAGTGGGGGTGGG + Intronic
1153308556 18:3655077-3655099 TGGGAAATTGCAGTGGGGGTTGG - Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153734693 18:8053437-8053459 GGGGAAACACAAGTGGTGCTAGG - Intronic
1155557310 18:27034019-27034041 AGGGAAGCAGCAGTGCGGATGGG - Intronic
1155716153 18:28946123-28946145 TGGTCAACAGCAGTGGGGTTTGG + Intergenic
1156362939 18:36400406-36400428 CAGGAAAGAGCTGTGGGGGTAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158828517 18:61251886-61251908 TGGGAGACAGCAGGGAGGCTGGG - Intergenic
1159704805 18:71674173-71674195 CGGGAAGCAGCGGTAGGGCCAGG - Intergenic
1161029186 19:2050201-2050223 CAGGAAACAGCACTTGGGCCTGG + Intronic
1161937546 19:7381379-7381401 TCCGAAACAGCAGTGGGGCTTGG + Intronic
1163113500 19:15175834-15175856 TGGGAAACAGCAGAGAGGCCAGG + Intronic
1164676382 19:30104328-30104350 CTGGAAAAAGCAGTGCAGCTGGG - Intergenic
1165990537 19:39809752-39809774 GTGGAAACAGCAGTGTGTCTGGG + Intergenic
1166369336 19:42292570-42292592 CGGGAGCCAGCAGTGGGGCTTGG - Exonic
1167998512 19:53426104-53426126 AGGGACCCACCAGTGGGGCTGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925217671 2:2111065-2111087 AGGGACACAGCAGTGGGCCCTGG + Intronic
926315618 2:11707605-11707627 CGGGAGAGAGCAGCGTGGCTGGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929597435 2:43185211-43185233 CGGGGAACACCAGTAGGGGTTGG - Intergenic
929950246 2:46404490-46404512 CAGGTGACAGCAGTGGGGATAGG + Intergenic
931005947 2:57850224-57850246 AGGAGAGCAGCAGTGGGGCTTGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932644725 2:73488390-73488412 CGGGAACCAGGAGTGGGGAGAGG + Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934568041 2:95351381-95351403 AGGGAGACAGCATTGGGGTTGGG + Intronic
935482105 2:103603150-103603172 CTGGAAACAGAAGTGGGTTTGGG + Intergenic
937868507 2:126771349-126771371 CAGGAGGCAGCAGTGGGGCAAGG + Intergenic
938821800 2:134967806-134967828 GGAGAAACAACAGTGGGCCTAGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939801953 2:146721219-146721241 GGGAAAGCAGCAGTGGGACTGGG + Intergenic
940129938 2:150369793-150369815 TGGGAAGCAGCAGTAGAGCTAGG + Intergenic
940582525 2:155600431-155600453 CGGGAAGCATCAGTGGGACCGGG - Intergenic
941063308 2:160872491-160872513 TGGGTAACAGCAGTGGAGGTAGG + Intergenic
941929117 2:170923633-170923655 TGGGAAGCAGCAGCGGGGCTGGG - Intergenic
942189809 2:173458157-173458179 AAAGAAACAACAGTGGGGCTGGG + Intergenic
945116134 2:206409868-206409890 TGGGAAACTGCAGGGGGGCAGGG + Intergenic
945148724 2:206765460-206765482 CTGCATACAGGAGTGGGGCTCGG - Exonic
948781458 2:240324229-240324251 CCTCAAACAGCAGTGGGGCCCGG + Intergenic
1168971446 20:1933713-1933735 CAGAAATGAGCAGTGGGGCTTGG - Intronic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171096791 20:22340036-22340058 CTGCAAACTGCAGTTGGGCTTGG + Intergenic
1171152705 20:22842047-22842069 TGGGAGACAGCAGTTGGGGTGGG - Intergenic
1171245359 20:23606256-23606278 CTGGACTCAGCAGTGGGGGTGGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173857949 20:46262968-46262990 GAGGAAAGGGCAGTGGGGCTGGG - Intronic
1175461149 20:59152813-59152835 AGGCAACCAGAAGTGGGGCTTGG + Intergenic
1175490345 20:59376299-59376321 TGGGAGTCAGCTGTGGGGCTTGG - Intergenic
1175885275 20:62286770-62286792 CAGGGAAGAGCCGTGGGGCTGGG - Intronic
1176103076 20:63373270-63373292 CGGGCAACAGCTGGGGGCCTTGG + Intronic
1177112866 21:17049520-17049542 TGGGAAGCAGTGGTGGGGCTGGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1181557225 22:23678067-23678089 AGGGAAACAGCAGAGGGGCTGGG - Intergenic
1181697155 22:24599493-24599515 AGGGAAACAGCAGAGGGGCTGGG + Intronic
1182715329 22:32353287-32353309 CGGGAACCAGCACTAGGGTTGGG - Intergenic
1182796887 22:32997487-32997509 AAGGAGACAGAAGTGGGGCTGGG - Intronic
1183982466 22:41549657-41549679 TGGGAAACTGCAGCGGGGCCAGG + Intergenic
1184459864 22:44630988-44631010 GGGGAGCCAGGAGTGGGGCTGGG + Intergenic
1184554650 22:45226544-45226566 CTGGAAACAGCTGTGGGGTCGGG - Intronic
1184669782 22:46006636-46006658 CGGGAGGCAGCAGTGGAGCTGGG - Intergenic
1185271396 22:49930803-49930825 CGGGACACCGGAGTTGGGCTTGG + Intergenic
1185276920 22:49953829-49953851 CAGGAAGCAGCAGCGGGGCCGGG + Intergenic
949881360 3:8663548-8663570 GGGGCCACAGCAGTGGGGCGGGG + Intronic
950998179 3:17527394-17527416 GGGGAAACAGAAGAGAGGCTGGG + Intronic
951206830 3:19934233-19934255 TGGGAAACAGGGGCGGGGCTTGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951490115 3:23260805-23260827 AGGGAGACAGTAATGGGGCTGGG + Intronic
954497878 3:50982717-50982739 GGGGTCACTGCAGTGGGGCTGGG + Intronic
956798973 3:72739769-72739791 AAGGAAACAGGAGTGGGGCAGGG + Intergenic
959254521 3:103992049-103992071 CGGGACACTGCAGTGGGGTGGGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960948383 3:122982605-122982627 GGGGAAACAGGAGGAGGGCTGGG - Intronic
961626545 3:128268069-128268091 CTGGAAACAGAAGTGAGGCTAGG + Intronic
962763750 3:138542551-138542573 TGGGAAGCAGCTGTGGGGCCAGG - Intronic
963090290 3:141477405-141477427 GGTGAATCAGCAGTGAGGCTGGG + Intergenic
963459562 3:145591560-145591582 CTGGGAAGAGCAGTGGGGGTGGG + Intergenic
969012189 4:4075200-4075222 AGAGAAACAGCAGTGGGCCCAGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969461440 4:7331217-7331239 CTGGAGACTGCTGTGGGGCTCGG + Intronic
969600152 4:8171397-8171419 AGGGCAACAGGAGTGGGGCTGGG - Intergenic
969753459 4:9131252-9131274 AGGGAAACAACAGTGGGTCCAGG - Intergenic
969760383 4:9176876-9176898 AGGGAAACAACAGTGGGTCCAGG + Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
972075350 4:35079805-35079827 TGGGAAGCAGTAGTGGGGCCGGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
973014950 4:45126474-45126496 TGTGTAACTGCAGTGGGGCTGGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
976178912 4:82381000-82381022 TGGGAAGCAGTGGTGGGGCTGGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978587979 4:110293476-110293498 GGACAAAAAGCAGTGGGGCTTGG + Intergenic
979489755 4:121311743-121311765 CTGGAGCCAGCAGTGGGGATTGG + Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981522035 4:145672447-145672469 CGAGAAAGAGAAGTGGGGGTAGG - Intergenic
982652607 4:158105398-158105420 CTGGAAATAGCCATGGGGCTTGG + Intergenic
983352016 4:166602186-166602208 CAGGAAGCAGCAGCGGGACTGGG + Intergenic
983608074 4:169612666-169612688 TGGGAAGGAGCAGTGAGGCTGGG + Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984064649 4:175033108-175033130 TGGGAAGTAGCAGTGGGGCTAGG - Intergenic
984423189 4:179551092-179551114 GGGGAAACAGCAGTGGTCCTGGG + Intergenic
984520145 4:180792267-180792289 TGGGAAGCAGCACTGGGGATAGG + Intergenic
985046817 4:185949074-185949096 CAGGAAACAGGAGGGGGGTTGGG + Intronic
986950714 5:13080938-13080960 TGGGAAGCAGCAGCAGGGCTGGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989475442 5:41869242-41869264 CAGGAAAGAGCAATGGGGCCAGG + Intronic
991045797 5:62221506-62221528 GGGGATACAGCACTGGGGCCAGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
998465223 5:142338231-142338253 AGTGAAACAGCAGAGGGCCTGGG - Intergenic
998479543 5:142451314-142451336 CGGGATACAGCTGTGTTGCTTGG + Intergenic
998873659 5:146577293-146577315 AGGGATGGAGCAGTGGGGCTGGG - Intergenic
999147956 5:149408114-149408136 CGGGATGAAGCAGTGGGGCCAGG + Intergenic
1003162782 6:3650637-3650659 TGGGAAACAGGAGTGGGGCTGGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005658411 6:27967322-27967344 TGGGAAGCAGCCGTGTGGCTGGG - Intergenic
1005908298 6:30284833-30284855 GTGGAAACAGCAGTGGAACTGGG - Intergenic
1006644319 6:35505730-35505752 CGGGAAGCTGAGGTGGGGCTGGG - Exonic
1006730233 6:36230862-36230884 GTAGAAACAGCTGTGGGGCTTGG + Exonic
1007078962 6:39085354-39085376 CGGGAAACAGCAGGGAGGAAGGG - Intronic
1007367794 6:41406988-41407010 CGGGAAACAGGCTTGGGCCTCGG + Intergenic
1008140354 6:47824649-47824671 TGGGAACCTGCAGTTGGGCTGGG - Exonic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009229363 6:61043668-61043690 TGGTGAACAGCAGTGGGGGTGGG + Intergenic
1009338876 6:62529072-62529094 CAGGAAACAGCAGTCGCTCTAGG + Intergenic
1009546057 6:65020977-65020999 CTGCACACAGCAGTGGGGCCCGG + Intronic
1011812546 6:91149813-91149835 TGGGCAACACCAGAGGGGCTTGG - Intergenic
1012316848 6:97791419-97791441 CAGGAAGCAGCGGTGGGGCTGGG - Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013480790 6:110551040-110551062 CGGGAGAGGGCAGTGGCGCTGGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1016583842 6:145661410-145661432 CAGGATAGAGCAGTGGGGTTGGG - Intronic
1017372938 6:153735132-153735154 CAGGAAGCAGCAGTGGGGCCAGG - Intergenic
1017396201 6:154002549-154002571 CAGGAAGCAGTGGTGGGGCTGGG - Intergenic
1017594781 6:156016793-156016815 TGGGAATCTGCAGTGAGGCTGGG - Intergenic
1019268720 7:133926-133948 AGGGAAGCAGGAGTGGGGTTAGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021787364 7:24165132-24165154 CAGGAAGGGGCAGTGGGGCTGGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1024327335 7:48119423-48119445 AGGGAAACAAAAGTGGGGTTAGG + Intergenic
1027339376 7:77189686-77189708 TGTGAAACAGCAGAGGGTCTGGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028401868 7:90433377-90433399 TGGGAAGCAGTGGTGGGGCTAGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029076805 7:97941110-97941132 GGAGAAACAACAGTGGGCCTAGG + Intergenic
1031239414 7:119219194-119219216 TGGGTAACAGGAGTGGGTCTAGG + Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032223267 7:130010211-130010233 GTGGAAACAGCAGTGGGGAAAGG + Intergenic
1032649075 7:133857938-133857960 CGGGAAGCAGCAATGGGGCCAGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035418345 7:158707411-158707433 TGGGAAGCAGCGGTGGGGCCGGG - Intergenic
1036261085 8:7240747-7240769 GGAGAAACAACAGTGGGCCTAGG + Intergenic
1036305524 8:7598800-7598822 GGAGAAACAACAGTGGGCCTAGG - Intergenic
1036313124 8:7699291-7699313 GGAGAAACAACAGTGGGCCTAGG + Intergenic
1036356374 8:8046797-8046819 GGAGAAACAACAGTGGGCCTAGG - Intergenic
1036376675 8:8206584-8206606 AGGGAAACAACAGTGGGTCCAGG - Intergenic
1036846132 8:12172031-12172053 AGGGAAACAACAGTGGGTCCAGG - Intergenic
1036852862 8:12216554-12216576 AGGGAAACAACAGTGGGTCCAGG + Intergenic
1036874235 8:12459076-12459098 AGGGAAACAACAGTGGGTCCAGG + Intergenic
1037253102 8:16920006-16920028 CGGCAGGCACCAGTGGGGCTGGG + Intergenic
1037759787 8:21734138-21734160 CTGGAAGAAGCAGAGGGGCTTGG + Intronic
1038310817 8:26444956-26444978 CTGGACACAGCAGTGGGGTGAGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041953878 8:63536272-63536294 CGGGAAGCTGCAGTGGGGAATGG + Intergenic
1042751102 8:72158520-72158542 TGGGAAACAGCAGTGTGTCCAGG - Intergenic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046194795 8:110847422-110847444 CTGGAAATAGCAGTGGGGAGGGG + Intergenic
1046560864 8:115835805-115835827 TAGGAAACAGCAGAGGAGCTGGG + Intergenic
1048048052 8:130791773-130791795 CTGTAAACACCTGTGGGGCTCGG - Intronic
1049202324 8:141346393-141346415 CAGCGAAGAGCAGTGGGGCTGGG - Intergenic
1049376086 8:142289858-142289880 CGGGCAGGCGCAGTGGGGCTGGG + Intronic
1049585527 8:143430887-143430909 CGGGAAACAGCTGTGGGAAGAGG + Intergenic
1049780469 8:144426435-144426457 CGGGGAGCCGCAGTGGAGCTGGG - Intronic
1049780485 8:144426483-144426505 CGGGGAGCCGCAGTGGAGCTGGG - Intronic
1050589605 9:7148410-7148432 CGGGAAAGAGCTGTGGGGCCAGG - Intergenic
1051199066 9:14597326-14597348 CTGGACTCAGCAGTGTGGCTGGG + Intergenic
1051612141 9:18971282-18971304 AGGCAAGCAGCAGTGGGGCATGG - Intronic
1051663952 9:19450830-19450852 TGGGAAACTGCAGGGGGGCAGGG - Exonic
1052437225 9:28444380-28444402 ACAGAAGCAGCAGTGGGGCTGGG + Intronic
1053016345 9:34664486-34664508 CGGCAAAGAGCAGTGGCCCTTGG + Exonic
1055051355 9:71984646-71984668 AGCGCAACAGCTGTGGGGCTGGG - Intronic
1055585504 9:77755226-77755248 CTGGAAAGGGTAGTGGGGCTGGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057928111 9:99170748-99170770 CGGGGAGCAGGGGTGGGGCTGGG + Intergenic
1059849185 9:118318140-118318162 AGGGAAGCCACAGTGGGGCTTGG - Intergenic
1060864960 9:126988311-126988333 CAGGAGACGGCAGTGAGGCTTGG + Intronic
1060911799 9:127357138-127357160 AGGGAATGGGCAGTGGGGCTTGG + Intronic
1061258019 9:129464065-129464087 CGGGAACCCACAGTTGGGCTGGG - Intergenic
1061420687 9:130471617-130471639 CGGGGGCCAGCCGTGGGGCTGGG + Intronic
1061518016 9:131100775-131100797 AGAGAAGCAGGAGTGGGGCTGGG + Intronic
1061620629 9:131809341-131809363 CAGGCACCAGCAGTGGTGCTGGG - Intergenic
1062075958 9:134590108-134590130 CAGGCAAAAGCAGAGGGGCTGGG + Intergenic
1062507858 9:136887043-136887065 CGGGGAAGACCAGTGAGGCTGGG + Intronic
1062520382 9:136955226-136955248 AGGGGACCAGCAGTGGGTCTAGG - Intronic
1186588597 X:10903753-10903775 AGGGAAACATCAGTGAGGCCAGG + Intergenic
1187625051 X:21102002-21102024 CTGGGAAAAGCAGTGGGGGTGGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1189994991 X:46629585-46629607 TGGGAAACAGCAAAGGGGGTGGG + Intronic
1190542874 X:51496521-51496543 CGGGGAACAGCCGAGGTGCTGGG + Exonic
1190737717 X:53266775-53266797 GAGGAGACAGCAGTGGGGATGGG + Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191207907 X:57853667-57853689 GGGGAAGCAGCAGTGGGGTGAGG + Intergenic
1193219471 X:78906130-78906152 CTGGAAAGAGTAGTGGGGATGGG - Intergenic
1193594456 X:83429335-83429357 CTGGGAACGGCAGTGGGGCCTGG + Intergenic
1194219277 X:91171180-91171202 AGGGAAACAACAGTGGGCCCAGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198129577 X:133680266-133680288 AGGGATACAGCAGTTGGGGTTGG - Intronic
1198158664 X:133985989-133986011 CGGGAAGGAGGAGTGAGGCTGGG - Intergenic
1198481724 X:137047361-137047383 TGGGACACACCAATGGGGCTTGG + Intergenic
1198594855 X:138225071-138225093 AGGGAAAGAGCAGTGGGGTCAGG + Intergenic
1199779005 X:151041159-151041181 TGTGAGACAGCAGTGAGGCTGGG - Intergenic
1200038652 X:153349916-153349938 CCGCCAGCAGCAGTGGGGCTTGG + Exonic
1200048413 X:153414990-153415012 CGGGAAACAGCAGCTGGGGCCGG + Intergenic
1202579639 Y:26366313-26366335 CAGGGAACAGCTGTGAGGCTGGG + Intergenic