ID: 1080488970

View in Genome Browser
Species Human (GRCh38)
Location 11:32742168-32742190
Sequence ATGCCCAGTAATGGCATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38381
Summary {0: 1, 1: 345, 2: 15025, 3: 11769, 4: 11241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080488970 Original CRISPR ATGCCCAGTAATGGCATGGC TGG Intronic
Too many off-targets to display for this crispr