ID: 1080493069

View in Genome Browser
Species Human (GRCh38)
Location 11:32788562-32788584
Sequence GAGGATCTCATGAGCTCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15215
Summary {0: 1, 1: 0, 2: 73, 3: 1481, 4: 13660}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080493069_1080493078 11 Left 1080493069 11:32788562-32788584 CCTCCGGAGCTCATGAGATCCTC 0: 1
1: 0
2: 73
3: 1481
4: 13660
Right 1080493078 11:32788596-32788618 TCCCAAGTAGCTGGGACTGCAGG 0: 1441
1: 46220
2: 159595
3: 222295
4: 230266
1080493069_1080493076 3 Left 1080493069 11:32788562-32788584 CCTCCGGAGCTCATGAGATCCTC 0: 1
1: 0
2: 73
3: 1481
4: 13660
Right 1080493076 11:32788588-32788610 CCTCAGCCTCCCAAGTAGCTGGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
1080493069_1080493074 2 Left 1080493069 11:32788562-32788584 CCTCCGGAGCTCATGAGATCCTC 0: 1
1: 0
2: 73
3: 1481
4: 13660
Right 1080493074 11:32788587-32788609 ACCTCAGCCTCCCAAGTAGCTGG 0: 12355
1: 109844
2: 220687
3: 278513
4: 285771

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080493069 Original CRISPR GAGGATCTCATGAGCTCCGG AGG (reversed) Intronic
Too many off-targets to display for this crispr