ID: 1080493598

View in Genome Browser
Species Human (GRCh38)
Location 11:32794475-32794497
Sequence TCCTTGCTCTGGTTGCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080493598_1080493605 -3 Left 1080493598 11:32794475-32794497 CCCCTTGGCAACCAGAGCAAGGA 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1080493605 11:32794495-32794517 GGAAGGGTAGGTTACGCAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 105
1080493598_1080493609 22 Left 1080493598 11:32794475-32794497 CCCCTTGGCAACCAGAGCAAGGA 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1080493609 11:32794520-32794542 GTGCAGGGCAAACCCGTAAGTGG 0: 1
1: 0
2: 1
3: 5
4: 47
1080493598_1080493608 7 Left 1080493598 11:32794475-32794497 CCCCTTGGCAACCAGAGCAAGGA 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1080493608 11:32794505-32794527 GTTACGCAGCTGGAGGTGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 126
1080493598_1080493606 0 Left 1080493598 11:32794475-32794497 CCCCTTGGCAACCAGAGCAAGGA 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1080493606 11:32794498-32794520 AGGGTAGGTTACGCAGCTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 69
1080493598_1080493607 6 Left 1080493598 11:32794475-32794497 CCCCTTGGCAACCAGAGCAAGGA 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1080493607 11:32794504-32794526 GGTTACGCAGCTGGAGGTGCAGG 0: 1
1: 0
2: 3
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080493598 Original CRISPR TCCTTGCTCTGGTTGCCAAG GGG (reversed) Intronic