ID: 1080496954

View in Genome Browser
Species Human (GRCh38)
Location 11:32829918-32829940
Sequence GGCGGCCGACGGAGGACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080496954_1080496969 20 Left 1080496954 11:32829918-32829940 CCTCCCGTCCTCCGTCGGCCGCC 0: 1
1: 0
2: 0
3: 21
4: 210
Right 1080496969 11:32829961-32829983 CTCACCCCGCGCGTGTTCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 88
1080496954_1080496962 -5 Left 1080496954 11:32829918-32829940 CCTCCCGTCCTCCGTCGGCCGCC 0: 1
1: 0
2: 0
3: 21
4: 210
Right 1080496962 11:32829936-32829958 CCGCCTCCCCGGACCGAGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 143
1080496954_1080496960 -9 Left 1080496954 11:32829918-32829940 CCTCCCGTCCTCCGTCGGCCGCC 0: 1
1: 0
2: 0
3: 21
4: 210
Right 1080496960 11:32829932-32829954 TCGGCCGCCTCCCCGGACCGAGG 0: 1
1: 0
2: 1
3: 11
4: 103
1080496954_1080496970 21 Left 1080496954 11:32829918-32829940 CCTCCCGTCCTCCGTCGGCCGCC 0: 1
1: 0
2: 0
3: 21
4: 210
Right 1080496970 11:32829962-32829984 TCACCCCGCGCGTGTTCCCCGGG 0: 1
1: 0
2: 0
3: 0
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080496954 Original CRISPR GGCGGCCGACGGAGGACGGG AGG (reversed) Intergenic
901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG + Intronic
901373244 1:8818008-8818030 GGCGGGCGGCGGAGGAGGGCCGG - Intergenic
902169417 1:14598521-14598543 GGCGGCGGACGGCAGTCGGGAGG - Intergenic
903013011 1:20343788-20343810 GGAGGCCGACGGGAGAGGGGGGG - Intronic
903268032 1:22170177-22170199 GAGGGCCCACGGAGGACTGGTGG + Intergenic
904461943 1:30685641-30685663 GGCGGGAGACGGAGGGCTGGAGG + Intergenic
905202252 1:36322943-36322965 GGCGGGCGCCGGAAGACTGGGGG - Intronic
906168956 1:43707760-43707782 CGCGGCCGGCGGGGGAGGGGCGG - Intronic
909650664 1:77972504-77972526 GGAGGCCGAGGCAGGGCGGGGGG + Intronic
910449554 1:87331624-87331646 GGCGGGCGGCGGAGGAGGGGAGG + Intronic
913972331 1:143424295-143424317 GGCTGCAGACGGAGGAGTGGAGG - Intergenic
914066713 1:144249908-144249930 GGCTGCAGACGGAGGAGTGGAGG - Intergenic
914112440 1:144716446-144716468 GGCTGCAGACGGAGGAGTGGAGG + Intergenic
914125463 1:144813786-144813808 GGCGGCCGGCGGCGGAGAGGCGG - Intergenic
914803160 1:150974758-150974780 GGCGGCTGGCGGAGGAGGGAGGG - Exonic
915213437 1:154325866-154325888 GGCGGCCGACTGGAGACGAGGGG + Intronic
915310235 1:155002742-155002764 GGCGGCCGAGGGGGGGCGGGCGG + Exonic
915912756 1:159924690-159924712 GGTGGCCGCGGGCGGACGGGCGG - Intronic
918547010 1:185696513-185696535 TGCAGCAGAAGGAGGACGGGTGG - Intergenic
919451158 1:197775015-197775037 GGCGGCCGAGGTTGGCCGGGCGG - Intronic
919809396 1:201399327-201399349 GGCGGCCGGCGGGGCGCGGGCGG - Exonic
920002024 1:202807338-202807360 GGCGGCGGGGGCAGGACGGGCGG - Intronic
921075735 1:211698971-211698993 GGCGGGGGACGGGGGGCGGGGGG - Intergenic
921089810 1:211831425-211831447 GGCGGGCGGGGGAGGGCGGGCGG - Intergenic
921472666 1:215567558-215567580 GGCGGCGGCCGGAGGGCGGGGGG - Exonic
922811155 1:228416420-228416442 GGCGGCCGGCGGAGGCGGGAAGG + Intronic
923013033 1:230104189-230104211 GGGGGCCGAGGGAGGCAGGGAGG + Intronic
1063050414 10:2441157-2441179 TGCGGCGGACAGAGGACTGGAGG + Intergenic
1063664716 10:8054460-8054482 GGCGGCCGCCGGCGGAGGGGCGG - Intronic
1065712757 10:28533224-28533246 GGCGGCGGGGGGAGGAGGGGAGG + Intronic
1066464825 10:35642056-35642078 GGCGGCGGACGGACGAAGGACGG - Exonic
1069885747 10:71622513-71622535 GGCGGGGGACGGAGGCAGGGTGG + Intronic
1069997846 10:72354091-72354113 TGCGGGCGATGGAGGACTGGCGG + Intronic
1074399082 10:113126887-113126909 CGCGGCCGGCGGCGGGCGGGCGG + Intronic
1075082496 10:119393279-119393301 GGCGGCAGAGGGAGCACGCGGGG - Intronic
1076676069 10:132148468-132148490 GGGGGTGGATGGAGGACGGGCGG - Intronic
1076676085 10:132148517-132148539 GGGGGCGGATGGAGGACGGGCGG - Intronic
1076793441 10:132788071-132788093 GGCAGCCCAGGGAGGACCGGGGG - Intergenic
1076916381 10:133424704-133424726 GGCTGGTGACGGAGGACGGGAGG - Intergenic
1076936488 10:133569499-133569521 GGCTGGTGACGGAGGACGGGAGG - Intronic
1076981861 11:208942-208964 AGCGGCCGCCTGAGGCCGGGGGG + Intronic
1077008185 11:369041-369063 GGCGGGCGAGAGAGGCCGGGGGG - Intergenic
1077138330 11:1012600-1012622 GGTGGCCCCCGGAGGACGGTGGG + Intergenic
1077307526 11:1874737-1874759 GGCTGCAGACGGAGGAGTGGAGG + Intronic
1080496954 11:32829918-32829940 GGCGGCCGACGGAGGACGGGAGG - Intergenic
1084171207 11:67401827-67401849 GGAGGCTGCCGGAGGGCGGGAGG - Intronic
1084953350 11:72678656-72678678 GGAGGCCGACGGAAATCGGGTGG + Intergenic
1085012090 11:73148249-73148271 GGATGCCCACGGAGGACAGGCGG - Intergenic
1089160400 11:116432694-116432716 GGAGGCTGACAGAGGACGGGTGG + Intergenic
1091781899 12:3219103-3219125 GGCGGCCGGGGGAGGCCGGACGG + Intronic
1092246557 12:6867403-6867425 GGCGGCGGCAGGAGGGCGGGCGG + Exonic
1093583232 12:20807507-20807529 GGCGGCGGGGGGAGGAGGGGCGG + Intergenic
1095954168 12:47797034-47797056 GGCCGCCGCCGGAGGCTGGGGGG + Exonic
1096073600 12:48789017-48789039 GGCGGACGGCGGACGGCGGGCGG - Intronic
1096073601 12:48789020-48789042 GACGGCGGACGGCGGACGGCGGG - Intronic
1096077642 12:48815146-48815168 AGCCGCCGCCGGAGGATGGGCGG + Intronic
1096710482 12:53452171-53452193 GGCGGCGGAGGGCGGGCGGGCGG - Exonic
1096710484 12:53452175-53452197 GGAGGGCGGCGGAGGGCGGGCGG - Exonic
1096710513 12:53452244-53452266 GGCGGGCGGAGGAGGAAGGGGGG - Exonic
1103698553 12:122835668-122835690 GGCGGGCGGCGGCGGGCGGGCGG + Intronic
1104920133 12:132286212-132286234 GGCGGGCGTCGGGGGATGGGGGG + Intronic
1106087684 13:26557888-26557910 GGCGGCTGTCGGGGGAGGGGCGG + Intronic
1107119149 13:36778706-36778728 GGGGGCGGAGGGAGGATGGGGGG - Intergenic
1110219583 13:73059219-73059241 GGCTGCCGGCGGAGGAGGGGAGG - Exonic
1113543212 13:111124692-111124714 GGGAGCAGACGGAGGATGGGTGG - Intronic
1113917771 13:113884408-113884430 GGCGCCCGATGGTGGGCGGGGGG + Intergenic
1115961235 14:38837592-38837614 GGCGGCCGAGTGAGGCTGGGAGG - Intergenic
1118017454 14:61674657-61674679 GGGGCCCGTCGGAAGACGGGGGG - Intergenic
1119248995 14:73136391-73136413 GCCGGCCCACGGAGGAGGGGAGG - Intergenic
1119655440 14:76413918-76413940 GGCGGCGGACGGTGCAGGGGCGG - Intronic
1119655459 14:76413971-76413993 GGCGGCGGACGGTGCAGGGGCGG - Intronic
1119655465 14:76413989-76414011 GGCGGCGGACGGTGCAGGGGCGG - Intronic
1119655492 14:76414059-76414081 GGCGGCGGACGGTGCAGGGGCGG - Intronic
1122053690 14:99077935-99077957 GGAGGCAGACAGAGGAAGGGAGG + Intergenic
1122183413 14:99971743-99971765 GGCCGCCGCCGGGGGATGGGGGG - Intronic
1122970311 14:105149783-105149805 GGCGGCCGAGGGTGGTAGGGAGG + Intronic
1123684394 15:22786850-22786872 GGCGGCAGGCGGCGGGCGGGTGG + Intronic
1125485572 15:40108739-40108761 GGTGGCCGCCGGGGGCCGGGCGG - Intronic
1130613346 15:85380894-85380916 GGCGGGCCCCGGAGGAGGGGCGG + Intronic
1132055637 15:98648849-98648871 GGCGGCGGGCGGGGGCCGGGCGG + Intergenic
1132841175 16:1979166-1979188 GGCGCCCGGCGAAGGTCGGGTGG + Exonic
1136237813 16:28925280-28925302 GGCCCCGGACGGAGGATGGGGGG + Exonic
1141054599 16:80803964-80803986 GGCGGCGGGCGGCGGGCGGGAGG + Intronic
1141959156 16:87392720-87392742 GGCAGCCGGCGGAGGGCGGGCGG + Intronic
1141972583 16:87493196-87493218 GACGGCCGCCGAGGGACGGGAGG - Intergenic
1142252580 16:88999569-88999591 GGCGGAGGGCGGAGGGCGGGGGG + Intergenic
1142252691 16:88999804-88999826 GGCGGAGGGCGGAGGGCGGGGGG + Intergenic
1142284303 16:89165507-89165529 GGCTGCCCAGGGAGGGCGGGCGG - Intergenic
1142350298 16:89576442-89576464 GCCGGCCGACGGGGGGCGGGAGG + Intronic
1142374745 16:89701235-89701257 TGCGGCGGACGGGGGTCGGGGGG + Intronic
1142764167 17:2056443-2056465 AGCGGCCGCCGGTGGAGGGGAGG - Intronic
1143237982 17:5419626-5419648 GGCGGCCGCCGAGGGACCGGTGG - Exonic
1144046105 17:11456169-11456191 GGTGGGAGACGGAGGACCGGAGG + Intronic
1146052805 17:29566798-29566820 GGCGGACGGCGGAGGCCCGGCGG - Exonic
1151674129 17:75589220-75589242 GGCGGCCGCCAGAGGGCGAGGGG + Intergenic
1152192475 17:78897097-78897119 GGAGGCCGGCGGGGGGCGGGGGG - Intronic
1152357350 17:79813547-79813569 GGCGGCCGGAGGGGGGCGGGCGG + Intergenic
1152362346 17:79838707-79838729 GGAGGCCGGCGGAGGGAGGGAGG - Intronic
1152380703 17:79941106-79941128 GCCTGCAGACAGAGGACGGGGGG + Exonic
1152680721 17:81666541-81666563 GGTGGTCGAGGGAGGCCGGGCGG - Exonic
1152744184 17:82031594-82031616 CGCGGCCGGCGGGGGGCGGGGGG - Intergenic
1152744882 17:82034029-82034051 GGCCCCCGCCGGAGGCCGGGAGG + Exonic
1152870722 17:82751789-82751811 GGCCGCCGCCGGAGGACAGCGGG - Intergenic
1153515234 18:5895633-5895655 GGCGGGCGGCGGAGGACGCGGGG - Intronic
1154202297 18:12308099-12308121 AGCAGCCGAGGGAGGACGCGCGG - Exonic
1156502033 18:37566185-37566207 GGCCGCCGACGGGGGAGGCGCGG - Intergenic
1157614066 18:48976424-48976446 GGCGGCCGCCGGGTGACTGGAGG - Intergenic
1159040749 18:63320592-63320614 GGCGGACGACGGAGTGCGGAGGG + Intergenic
1160024900 18:75209161-75209183 GGCGCCGGCCGGAGGAGGGGCGG - Exonic
1160567077 18:79792840-79792862 GGCAGCGGGCGGAGGTCGGGAGG + Intergenic
1160813008 19:1021042-1021064 GGCGGCCGATGGCGGCCGGGAGG - Exonic
1162784355 19:13024974-13024996 GCGGGGCGAGGGAGGACGGGAGG - Intronic
1163426695 19:17244413-17244435 GGCGGCAGACGGAGGGAGGCTGG - Intronic
1165157278 19:33796261-33796283 GCCGGCCGGCGGGGGGCGGGGGG + Intronic
1165213765 19:34254823-34254845 GCCGGCCGACGGAAGCCCGGAGG + Intronic
1165437959 19:35806928-35806950 GGCGGCTGAGGGAGGCCCGGAGG + Intronic
1165437978 19:35806993-35807015 GGCGGCAGAGGGAGGCCCGGAGG + Intronic
1165437997 19:35807058-35807080 GGCGGCTGAGGGAGGCCCGGAGG + Exonic
1165476275 19:36032686-36032708 GGCGGCCCGCGGAGAAGGGGAGG - Intronic
1167466059 19:49651636-49651658 GGCGGCCGGTGTAGGCCGGGCGG - Exonic
1167913966 19:52725376-52725398 GGAGGCCGACGGGGGCTGGGAGG + Intronic
1202693080 1_KI270712v1_random:105002-105024 GGCGGCCGGCGGCGGAGAGGCGG + Intergenic
926130969 2:10302918-10302940 GGCGGCGGGCAGCGGACGGGCGG + Intronic
929126600 2:38528220-38528242 GGCGGCCGGCGGGGGAGGAGGGG - Intergenic
929188738 2:39120803-39120825 GGCGGCTGGGGGAGGACGTGTGG + Intronic
933747904 2:85584368-85584390 GGCCGCCGAGCGAGGGCGGGGGG - Intergenic
934067089 2:88350552-88350574 GGCGGCCACCGGGGGAGGGGAGG - Intergenic
934177024 2:89585233-89585255 GGCTGCAGACGGAGGAGTGGAGG - Intergenic
934287332 2:91659592-91659614 GGCTGCAGACGGAGGAGTGGAGG - Intergenic
934712977 2:96527672-96527694 GGCAGCGGAGGGAGGACTGGGGG - Intergenic
936500488 2:113062432-113062454 GGCTGCCGGCAGAGGAGGGGAGG - Exonic
945036632 2:205709096-205709118 GACAGCAGATGGAGGACGGGTGG + Intronic
945234834 2:207624841-207624863 AGCAGCCGATGGAGGAGGGGAGG - Intronic
947860626 2:233354862-233354884 GGCCCCCGACGGACGGCGGGCGG + Intronic
949034488 2:241810294-241810316 GGCGGCCGAGGGGCCACGGGGGG + Intronic
1168755027 20:310391-310413 GGGGGCCGGCGGAGGAGGCGTGG - Intergenic
1169278424 20:4248684-4248706 GGCGGCCGTCGGGGGACTGGTGG - Exonic
1172118692 20:32585452-32585474 GGCGGGCGCAGGAGGAAGGGGGG - Intronic
1172273400 20:33667116-33667138 TGCGGCCCAGGGAGGACGGCCGG - Exonic
1174381101 20:50155801-50155823 GGCGGCGGACGGGGGGGGGGGGG + Intergenic
1175127158 20:56760906-56760928 AGCTGCCGAAGGAGGAAGGGAGG - Intergenic
1175199342 20:57266908-57266930 GGCGGCCCGAGCAGGACGGGTGG + Intergenic
1176062571 20:63178802-63178824 GGCGGCCGAGGGCGGCCGAGGGG + Intergenic
1176062645 20:63179013-63179035 GGCGGCCCCCGCGGGACGGGAGG + Intergenic
1179209367 21:39312976-39312998 GGCGGCGGGCGGCGGGCGGGGGG + Intronic
1179375459 21:40846765-40846787 GGCGGCGGGCGGCGGGCGGGCGG - Exonic
1180908362 22:19431568-19431590 GGCGGCGGCCGGAGGGCGGGTGG - Exonic
1180949441 22:19714563-19714585 GGCCGCCGGCGGGGGACGTGCGG - Exonic
1181666477 22:24401981-24402003 GGCGGCCGAGGTAGGGCAGGCGG - Intronic
1183427093 22:37745990-37746012 GGTGGCGGCCGGAGGGCGGGCGG - Intronic
1184276465 22:43411899-43411921 GGCGGGCGGCGGCGGGCGGGGGG + Intronic
1184368727 22:44069093-44069115 GGCGGACGTCGGAGGGCAGGCGG - Intronic
951558617 3:23945216-23945238 AGCGGCCGGCCGAGGGCGGGCGG + Intronic
952816578 3:37452360-37452382 GGCGGCCGGCTGGGGATGGGCGG + Exonic
961222592 3:125212386-125212408 GGCGGCCTGCGGAGGCCGCGGGG - Intronic
962520744 3:136195850-136195872 GGCCGCCGCCGGCGGGCGGGAGG + Intronic
963904510 3:150762822-150762844 TGGGGCCGGTGGAGGACGGGCGG + Exonic
964451525 3:156817130-156817152 GGCGGCCGTCGCCGGGCGGGAGG + Intergenic
966390821 3:179451175-179451197 GGCGGCCGACGCTGCCCGGGAGG - Intronic
967859687 3:194141554-194141576 GGCGGCGGCGGGAGGCCGGGAGG + Intergenic
968210754 3:196846777-196846799 GGAGGCCGAGGCAGGAAGGGAGG + Intergenic
968437430 4:601297-601319 GGAGGCTGACGCAGGACTGGGGG - Intergenic
969285296 4:6199184-6199206 GGCGGGCGGCGGAGGAGGGCTGG + Intronic
969874563 4:10126285-10126307 GGTGGCCTACGGAGGATTGGAGG + Intergenic
975139169 4:70902610-70902632 GGCGGGCGACGGGCGGCGGGCGG - Intronic
976765405 4:88592882-88592904 GGCGGCCGAGCGCGGGCGGGAGG - Intronic
984778542 4:183504736-183504758 GGCGGCCGCGGGCGGAGGGGCGG + Intergenic
984888956 4:184474586-184474608 CGCGGCCGGAGGAGGGCGGGGGG - Intergenic
985451631 4:190066403-190066425 GGCGGGCGACGGTGGCCCGGGGG - Intergenic
985616560 5:926565-926587 GGCGGCCCCCGCAGGGCGGGAGG - Intergenic
985660863 5:1155926-1155948 GGCGGGCGCGGGAGGCCGGGAGG + Intergenic
988263843 5:28926624-28926646 GGCTGCAGACGGAGGAGTGGAGG + Intergenic
997266326 5:132497114-132497136 GGCGGGGGCCGGGGGACGGGCGG + Intergenic
1001382006 5:171311388-171311410 GGCGGCAGACGGCGGAGGAGCGG + Exonic
1001586002 5:172834304-172834326 GGCGGCCGGCGGGGGCGGGGCGG + Exonic
1002190163 5:177473667-177473689 GCCGGCCGGCGGGGGGCGGGGGG + Intronic
1002925857 6:1605297-1605319 GCCGGCCGTCGGAGGACTGCAGG - Intergenic
1002991856 6:2245716-2245738 GGTGGCCGTCGGCGGAGGGGCGG - Intergenic
1003049252 6:2765425-2765447 AGCGGCCGGCCGAGGGCGGGCGG + Exonic
1003995749 6:11538028-11538050 GACGGCGGACGGAGGAAGGAGGG - Intergenic
1006107192 6:31723805-31723827 GGCGGCCGACGAAAGGCTGGAGG - Exonic
1006300974 6:33193374-33193396 GCCGGCCGGAGGAGGAAGGGGGG - Intergenic
1006331055 6:33391484-33391506 GGCGGCCGGAGGAGAAGGGGCGG - Intergenic
1006337566 6:33428323-33428345 GGGGGACAGCGGAGGACGGGAGG + Intronic
1006513789 6:34535027-34535049 GGCGGCAGACGGCGGGCGGTGGG - Exonic
1006860664 6:37170024-37170046 GCCGGCCGAGGGAGGAGAGGGGG - Intergenic
1007615806 6:43179367-43179389 GGAGGCTGAGGGAGGACGGGTGG - Exonic
1008629404 6:53348864-53348886 GGCGGCGGAGGGAGCGCGGGTGG + Exonic
1009396980 6:63211531-63211553 GGCGGCCGACGCCGAGCGGGCGG - Exonic
1011443087 6:87408154-87408176 GGCGGCTGGCGGAGCTCGGGCGG + Intronic
1019366469 7:635962-635984 CGCGGCCGGTGGAGGACGTGAGG - Intronic
1019366476 7:635986-636008 CGCGGCCGGTGGAGGACGTGAGG - Intronic
1019366483 7:636010-636032 CGCGGCCGGTGGAGGACGTGAGG - Intronic
1019366490 7:636034-636056 CGCGGCCGGTGGAGGACGTGTGG - Intronic
1019366497 7:636058-636080 CGCGGCCGGTGGAGGACGTGTGG - Intronic
1019366504 7:636082-636104 CGCGGCCGGTGGAGGACGTGAGG - Intronic
1019366511 7:636106-636128 CGCGGCCGGTGGAGGACGTGAGG - Intronic
1019366518 7:636130-636152 CGCGGCCGGTGGAGGACGTGTGG - Intronic
1019366525 7:636154-636176 CGCGGCCGGTGGAGGACGTGAGG - Intronic
1019366532 7:636178-636200 CGCGGCCGGTGGAGGACGTGTGG - Intronic
1019366539 7:636202-636224 CGCGGCCGGTGGAGGACGTGAGG - Intronic
1019366546 7:636226-636248 CGCGGCCGGTGGAGGACGTGTGG - Intronic
1019366553 7:636250-636272 CGCGGCCGGTGGAGGACGTGAGG - Intronic
1019366560 7:636274-636296 CGCGGCCGGTGGAGGACGTGAGG - Intronic
1019366567 7:636298-636320 CGCGGCCGGTGGAGGACGTGAGG - Intronic
1019366574 7:636322-636344 CGCGGCCGGTGGAGGACGTGTGG - Intronic
1019366581 7:636346-636368 CGCGGCCGGTGGAGGACGTGTGG - Intronic
1019366588 7:636370-636392 CGCGGCCGGTGGAGGACGTGTGG - Intronic
1019366595 7:636394-636416 CGCGGCCGGTGGAGGACGTGAGG - Intronic
1019366602 7:636418-636440 CGCGGCCGGTGGAGGACGTGTGG - Intronic
1019474655 7:1238243-1238265 GGGGGGAGATGGAGGACGGGTGG - Intergenic
1019578302 7:1748190-1748212 GGTGGCGGCGGGAGGACGGGCGG + Intergenic
1022207895 7:28180623-28180645 GGCGGGCGAGGGAGGGAGGGAGG + Exonic
1024940531 7:54759037-54759059 GGCGGCCGTCGCGGGGCGGGCGG - Intronic
1028417551 7:90596265-90596287 TGCGGCCGAAGGAGGAGGCGGGG - Intronic
1034435142 7:151059796-151059818 GGCCGCAGAGGGAGGAAGGGAGG + Intronic
1036694961 8:10968228-10968250 GGCAGCTGACGGAGGACGGAGGG - Intronic
1037815907 8:22111756-22111778 GGCAGCTGAGGGAGGACGGGAGG + Intergenic
1041167262 8:55102326-55102348 GGCGGGCGGCGGCGGACGGCAGG + Intergenic
1049310465 8:141931326-141931348 GGCAGCCTAAGGAGGAGGGGAGG + Intergenic
1049746884 8:144266764-144266786 GGCGCCCGGCGGAGGGCGGGGGG + Exonic
1057294651 9:93828063-93828085 GGCGGCCCAGGGCGGGCGGGCGG + Intergenic
1060825078 9:126683174-126683196 GGAGGCCGGGGGAGGCCGGGAGG + Intronic
1060979752 9:127785495-127785517 GGCGGGCGGAGGAGGAGGGGAGG + Intergenic
1061149073 9:128818755-128818777 GGCGGCGGCGGGAGGACGCGCGG + Exonic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062230685 9:135479998-135480020 GGCGGGCGGCGGGGGACGGGCGG + Exonic
1062238535 9:135524033-135524055 GGAGGCCGAGGGAGGAGGGAGGG - Intronic
1062421209 9:136483483-136483505 GGCGGCAGACGGACGCCGGAGGG - Exonic
1062445026 9:136590038-136590060 GGGGGTGGATGGAGGACGGGAGG - Intergenic
1195728039 X:107937184-107937206 GGCGGGGGACGGAGGGCGGAGGG - Intergenic
1195923548 X:110003959-110003981 GGCAGACGAAGGAGGACGGTAGG + Exonic