ID: 1080503594

View in Genome Browser
Species Human (GRCh38)
Location 11:32892610-32892632
Sequence TCCGGCTGGCGGGCGCCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080503586_1080503594 15 Left 1080503586 11:32892572-32892594 CCGGGCTGCGGAAGGCGGGAAGT No data
Right 1080503594 11:32892610-32892632 TCCGGCTGGCGGGCGCCCCTCGG No data
1080503582_1080503594 20 Left 1080503582 11:32892567-32892589 CCCTTCCGGGCTGCGGAAGGCGG No data
Right 1080503594 11:32892610-32892632 TCCGGCTGGCGGGCGCCCCTCGG No data
1080503584_1080503594 19 Left 1080503584 11:32892568-32892590 CCTTCCGGGCTGCGGAAGGCGGG No data
Right 1080503594 11:32892610-32892632 TCCGGCTGGCGGGCGCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080503594 Original CRISPR TCCGGCTGGCGGGCGCCCCT CGG Intergenic