ID: 1080503669

View in Genome Browser
Species Human (GRCh38)
Location 11:32892854-32892876
Sequence GGGACTCGCGGCGACGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080503669_1080503683 16 Left 1080503669 11:32892854-32892876 CCGCCGCCGTCGCCGCGAGTCCC No data
Right 1080503683 11:32892893-32892915 GCTTCCCTGACGCCCAGCTGGGG No data
1080503669_1080503681 14 Left 1080503669 11:32892854-32892876 CCGCCGCCGTCGCCGCGAGTCCC No data
Right 1080503681 11:32892891-32892913 CCGCTTCCCTGACGCCCAGCTGG No data
1080503669_1080503682 15 Left 1080503669 11:32892854-32892876 CCGCCGCCGTCGCCGCGAGTCCC No data
Right 1080503682 11:32892892-32892914 CGCTTCCCTGACGCCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080503669 Original CRISPR GGGACTCGCGGCGACGGCGG CGG (reversed) Intergenic
No off target data available for this crispr