ID: 1080505637

View in Genome Browser
Species Human (GRCh38)
Location 11:32910393-32910415
Sequence CCAGGCAATGAGCAAGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 841
Summary {0: 1, 1: 1, 2: 9, 3: 99, 4: 731}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080505637 Original CRISPR CCAGGCAATGAGCAAGGCAC TGG (reversed) Intronic
900430777 1:2602199-2602221 CCAGGGAAGGAGGCAGGCACAGG + Intronic
900844617 1:5086989-5087011 CCAGGGACTGAGCAAGGCAGGGG - Intergenic
901129896 1:6955672-6955694 CCAGGCACGGAGCTAGGGACCGG - Intronic
901438038 1:9261518-9261540 CCAGGCAATGTGCAGGGGAGTGG - Intronic
901670077 1:10850856-10850878 CCAGGCACACAGCAGGGCACAGG + Intergenic
901908563 1:12436078-12436100 CCAGGCTCTGTGCTAGGCACAGG + Intronic
902148985 1:14426963-14426985 CCAGGCACAGAGCTAGGTACTGG + Intergenic
902271653 1:15309335-15309357 CCAGGCACTGTTCTAGGCACTGG + Intronic
902718066 1:18286341-18286363 CCAGGCACTGTGCTAGGCTCTGG + Intronic
902785877 1:18732298-18732320 CCAGACACTAAGCCAGGCACTGG - Intronic
903046769 1:20570174-20570196 CCAGGCACTGTTCTAGGCACTGG + Intergenic
903223315 1:21880956-21880978 CCAGGCACTGAGCTAGGCACAGG + Intronic
903303964 1:22399751-22399773 CCAGGCACGGTGCTAGGCACTGG + Intergenic
903360559 1:22774327-22774349 CCAGGCCCTGAGCCAGGCACTGG - Intronic
903447671 1:23432612-23432634 CCAGGCTCTGCGCTAGGCACTGG + Intronic
903814725 1:26056709-26056731 CCAGGCACTGTGCTAGGCTCTGG + Intronic
903820886 1:26101692-26101714 CCAGGCACCGTGCTAGGCACTGG - Intergenic
903852064 1:26313570-26313592 CCAGGTACTGAACTAGGCACTGG - Intronic
904167448 1:28566907-28566929 CCAGGCACTGTGCTACGCACAGG - Intronic
904440750 1:30527939-30527961 CCAGGCCATGTGCAGGGCTCTGG + Intergenic
905251813 1:36654063-36654085 CCAGGCATTGTTCTAGGCACGGG - Intergenic
905325972 1:37152233-37152255 CCAGGCAGAGAGCATGGCATGGG - Intergenic
905338461 1:37261607-37261629 CCAGGCATTCTGCTAGGCACTGG - Intergenic
906330178 1:44877727-44877749 CCAGTCTATTAGGAAGGCACAGG + Intronic
906568932 1:46820032-46820054 CCATGCAATGGGCAAGACTCAGG - Intergenic
906680139 1:47720603-47720625 CCAGGCCCTGGGCCAGGCACAGG + Intergenic
907390355 1:54154104-54154126 CTATGCACTGAGCCAGGCACTGG - Intronic
907393708 1:54175295-54175317 CCAGGCACCGAGCTAGCCACTGG + Intronic
907464716 1:54627503-54627525 CCAGGCACTGTGCTAGGCTCTGG + Intronic
907491238 1:54810200-54810222 CCAGGCTCTGTGGAAGGCACCGG - Intronic
907728628 1:57044292-57044314 TCAAGCACTGAGCTAGGCACAGG - Intronic
907734787 1:57101705-57101727 CCAGGCACTCTGCTAGGCACTGG + Intronic
907794101 1:57697158-57697180 CCAGGAACTGTGCAAGGCATAGG - Intronic
907927606 1:58969172-58969194 CCAGGCACTGAGATTGGCACTGG + Intergenic
908368061 1:63447385-63447407 CCAGGCACTGTGCTAGGCTCTGG + Intronic
908392657 1:63697660-63697682 CCAGACGTTGTGCAAGGCACTGG - Intergenic
908406262 1:63816938-63816960 CCAGGCACTGTGCTGGGCACTGG + Intronic
908423864 1:63986013-63986035 CCAGGCACTGAGCAAAGCACTGG + Intronic
908537655 1:65093065-65093087 CCAAGCACTGTGCTAGGCACTGG + Intergenic
908814250 1:68015117-68015139 CCAGGTACTGTGCAAAGCACTGG - Intergenic
909168991 1:72270047-72270069 CAAGATAATGAGAAAGGCACTGG + Intronic
909948769 1:81693901-81693923 CCAGACACTGAGCTAGGCCCTGG + Intronic
910158909 1:84252819-84252841 CCAGGCACTATGCTAGGCACTGG + Intergenic
910964453 1:92794252-92794274 CCAGGCATTGTTCTAGGCACTGG + Intergenic
911042381 1:93600880-93600902 CCAGGCACTGGGCCAGGCTCTGG - Intronic
911088995 1:94002432-94002454 CCAGGCACTGAACCAGGCACTGG + Intronic
911566676 1:99470756-99470778 CCAGGCACTGTACAAGGCACTGG + Intergenic
912522459 1:110255141-110255163 CCAGGCTCTGTGCCAGGCACTGG - Intronic
912793843 1:112677951-112677973 GGAGGCAAGGACCAAGGCACAGG - Intronic
912858285 1:113191325-113191347 CCAGGCACTGGGCTGGGCACTGG + Intergenic
912869628 1:113292147-113292169 CCAGGCACTGTGCTAGGTACTGG - Intergenic
913237610 1:116798386-116798408 CCAGGCACTGTGTTAGGCACTGG + Intergenic
913239870 1:116820574-116820596 CCAGGCACTGTGCCAGACACTGG - Intergenic
913296129 1:117322344-117322366 CCAGGCACTGAGCTAGGATCTGG + Intergenic
913697456 1:121341294-121341316 CCAGGCACTGTGCTGGGCACTGG + Intronic
914140102 1:144938758-144938780 CCAGGCACTGTGCTAGGCACTGG - Intronic
915283573 1:154838827-154838849 CCAGGCACTGTGCAAGGTGCTGG - Intronic
915523976 1:156465010-156465032 CCAGGCACTGGGCGAGGCTCTGG + Exonic
915556833 1:156665384-156665406 CCAGGCACTGAGCTAGGCTCTGG + Intergenic
915626860 1:157119140-157119162 CCAAGCAGTGTGCTAGGCACTGG + Intergenic
916291385 1:163170294-163170316 CCAAGCATTGTGCTAGGCACAGG - Intronic
916478269 1:165191041-165191063 TCAGGCACTGTGCTAGGCACTGG + Intergenic
916693976 1:167218789-167218811 CCAGGCATTGTGCTAGGCACTGG + Intergenic
916801805 1:168222967-168222989 CCAGGCACTGTGCTTGGCACTGG + Intergenic
916986452 1:170197270-170197292 CCAGGCATTATGCTAGGCACTGG + Intergenic
917449832 1:175138288-175138310 CCAGGCTCTGAGATAGGCACTGG - Intronic
917985989 1:180319244-180319266 CAAGACACTGAGCTAGGCACTGG - Intronic
918081662 1:181212424-181212446 TCAGGCACTGTGCTAGGCACTGG - Intergenic
918409849 1:184247171-184247193 CCAGGCAAAGTGCTTGGCACAGG - Intergenic
919632398 1:199972031-199972053 CCAGGCACTGTTCCAGGCACTGG + Intergenic
919808433 1:201394743-201394765 CCAGGCTATGGACAAGGGACGGG - Intronic
919844571 1:201633557-201633579 CCAAGCAATGAGGAAGGAAATGG + Intronic
919867614 1:201794086-201794108 TCAGGCAATGGGCGAGGCATTGG - Intronic
919909386 1:202101437-202101459 CCAGGCACTGGGCTAGGCCCTGG - Intergenic
919988240 1:202690704-202690726 CTAGGCACTGAATAAGGCACTGG + Intronic
920311109 1:205048780-205048802 CCAGGCATTGTGCTAAGCACAGG - Intronic
920370814 1:205478095-205478117 CCAGGCACTGTGCCAGGCCCTGG + Intergenic
920484790 1:206359626-206359648 CCAGGCACTGTGCTAGGCACTGG + Intronic
920493295 1:206435962-206435984 CCAGACATTGTGCTAGGCACTGG - Intronic
920663602 1:207941828-207941850 CCAGGCACAGCGCCAGGCACTGG + Intergenic
920668908 1:207987996-207988018 CCAGGCATTGTGCTAGGCTCTGG - Intergenic
920678425 1:208054822-208054844 CCAGGCACTGCGCTAGGCATGGG - Intronic
920727238 1:208447667-208447689 CCAATCAATGTGCCAGGCACAGG + Intergenic
921366926 1:214383239-214383261 TCAGGCACTGAGCAAGGGGCAGG - Intronic
921405287 1:214772373-214772395 TCTTGAAATGAGCAAGGCACTGG - Intergenic
921744879 1:218728723-218728745 CCAAGCATTGAGCAAAGAACAGG + Intergenic
921893720 1:220378090-220378112 CCAGGTAATGAGCAAAGCTTTGG - Intergenic
922919902 1:229293594-229293616 CCAGGCCCTGTGCTAGGCACTGG + Intronic
922972622 1:229755675-229755697 CTAGGCACTGAGCTAGTCACTGG - Intergenic
923767160 1:236902613-236902635 GCAGGCACTGAGCTAGGCTCTGG - Exonic
924355798 1:243174170-243174192 CCAGGAAATGAGTAAGACTCAGG - Intronic
924651529 1:245932517-245932539 CCAGGCTTTGAGCCAGGTACAGG - Intronic
1063073866 10:2695007-2695029 TAAGGGAATGAGCAAAGCACAGG + Intergenic
1063139727 10:3245422-3245444 CAAGGCAATGATCAAGGCCAAGG + Intergenic
1063519841 10:6731253-6731275 CGAGGCAAAGGGCAAGGCAGTGG - Intergenic
1063964898 10:11339303-11339325 GCAGGCACTGTGCGAGGCACGGG - Intergenic
1064277337 10:13918233-13918255 CCAGGCACTGTTCAAGGCTCTGG - Intronic
1065004089 10:21363583-21363605 CCAGGCACTGAGCTTGGAACTGG + Intergenic
1065775326 10:29114471-29114493 CCAGACACTCAGCATGGCACTGG - Intergenic
1065955974 10:30693718-30693740 CCAAGCAATGAGTAAAGCATCGG - Intergenic
1067708886 10:48633120-48633142 CCAGGCACTGCTCTAGGCACTGG - Intronic
1067795609 10:49319203-49319225 CCAGGCAATGTTCTAGGCAATGG + Intronic
1068035184 10:51750506-51750528 CCAGGCAATGAGCTAGCTGCTGG + Intronic
1068337478 10:55654286-55654308 CCAGGCATTGTGCTAGTCACTGG + Intergenic
1068516202 10:58028447-58028469 CCAGGCACTGTGCTTGGCACTGG - Intergenic
1069706421 10:70461465-70461487 CCTGGCACTGTGCTAGGCACGGG - Intergenic
1070380077 10:75872946-75872968 CAGGGCATTGAGCAAGGTACTGG - Intronic
1070538623 10:77399800-77399822 CCTGGCACTGTTCAAGGCACTGG - Intronic
1070760048 10:79018500-79018522 CCAGGCACTCAGAAAGGCAAGGG + Intergenic
1070861477 10:79669046-79669068 CCAGGCACTGGGCTAGGCAAAGG + Intergenic
1070875769 10:79806543-79806565 CCAGGCACTGGGCTAGGCAAAGG - Intergenic
1070984303 10:80674594-80674616 CCAGGCACAGAGAAAGGCAGAGG + Intergenic
1071516074 10:86298756-86298778 CCAGGCTGGGAGCAGGGCACAGG - Intronic
1071521912 10:86336819-86336841 CCAGGCAGTCAGCAGGGCTCAGG - Intronic
1071642698 10:87328682-87328704 CCAGGCACTGGGCTAGGCAAAGG - Intergenic
1071797435 10:89021553-89021575 CCAGGGAAGGAGCAAGGGTCAGG - Intergenic
1072009332 10:91289926-91289948 CCAGGCATTGTGCTAGGCTCTGG + Intergenic
1072517816 10:96203134-96203156 CCAGGCATTGTTCTAGGCACAGG - Intronic
1072557410 10:96531454-96531476 CCAGGTATTGTGCTAGGCACTGG - Intronic
1072565531 10:96613838-96613860 CCAGGCACTGTGCTAAGCACTGG + Intronic
1072614537 10:97040558-97040580 CCAGGCACTGCACTAGGCACTGG - Intronic
1073361731 10:102904737-102904759 CCAGGCACTGTCCTAGGCACTGG + Intergenic
1073607658 10:104912703-104912725 CCAGGCATGGTGCAAGACACTGG + Intronic
1074208335 10:111303783-111303805 CCAGGAACTGTGCTAGGCACTGG - Intergenic
1074854618 10:117464383-117464405 CCAGGCACTGTGCCAAGCACTGG - Intergenic
1075209111 10:120476007-120476029 CCAGGCACTGTGCCAGGCCCAGG + Intronic
1075432572 10:122400830-122400852 CCAGGCACTGTGCTTGGCACTGG + Intronic
1075499565 10:122960519-122960541 CCAGGCACTGTGGAAGGCCCAGG - Intronic
1075595697 10:123727590-123727612 CCAGGCACTGTGCAAGGCTCAGG - Intronic
1075644414 10:124088131-124088153 CCAGGCACTGTGCCAAGCACTGG + Intronic
1075657302 10:124170471-124170493 CCAGGCACTGTGCTAGGCTCTGG - Intergenic
1075995191 10:126871386-126871408 CCAGGCACTGTGCTTGGCACTGG + Intergenic
1076109418 10:127849477-127849499 GCAGGCAAGGAGGAAGGCCCTGG + Intergenic
1076180304 10:128401907-128401929 CCTGGCCATGAGCAAGCCTCTGG - Intergenic
1076322397 10:129593170-129593192 CGAGGGAATGAGCAGGGCATAGG - Intronic
1077382120 11:2249020-2249042 CCAGGCAATGAAAATGGCAATGG + Intergenic
1077890589 11:6415353-6415375 CCAGGCACTGTGCTAGACACAGG + Intronic
1078064251 11:8067606-8067628 CCAGGCACTGTACTAGGCACTGG + Intronic
1078093947 11:8284995-8285017 CCTGGCATTAAGCCAGGCACTGG - Intergenic
1078183705 11:9033456-9033478 TCAGGCACTGACCTAGGCACTGG + Intronic
1078655758 11:13237413-13237435 CCAGGCACTATGCAAGGCTCTGG - Intergenic
1078903746 11:15665550-15665572 CCAGGCATTGTGTAAGGCACTGG + Intergenic
1078908318 11:15707934-15707956 CCAGGCACTACGCAAGGCACTGG - Intergenic
1079391961 11:20029627-20029649 CCAGGCACTGTGCAAGGCGGTGG - Intronic
1080505637 11:32910393-32910415 CCAGGCAATGAGCAAGGCACTGG - Intronic
1080779290 11:35416188-35416210 ACAGGCAAAGATCAATGCACAGG + Intronic
1080931583 11:36817029-36817051 CCAAGTACTGAGCTAGGCACAGG - Intergenic
1081756721 11:45549937-45549959 CCAGGCACTGGGCAAGGCTAGGG - Intergenic
1082039069 11:47669970-47669992 CCAAGCAGTGTGCTAGGCACAGG + Intronic
1082802052 11:57421917-57421939 CCAGGCATTGTGCTTGGCACTGG + Intronic
1083166519 11:60891426-60891448 CCAGGCACTGAGGGAGGCACTGG - Intronic
1083603110 11:63961230-63961252 CCAGGCATCGAGCTAGGCACGGG - Intergenic
1083676585 11:64329235-64329257 CCAGGCACTGTGCGAGGCTCTGG + Intergenic
1083746588 11:64740374-64740396 CCAGGCACTGTGCTAGGCGCTGG + Intronic
1084105620 11:66978401-66978423 CCAGGCCCAGAGCTAGGCACTGG - Intergenic
1084414836 11:69025791-69025813 CCAAGCATTGAGAAAGACACTGG - Intergenic
1084499415 11:69525924-69525946 CCAGGCACTGTTCCAGGCACGGG - Intergenic
1085043539 11:73340719-73340741 CCAAGCAATGAGCCAGGGATGGG + Intronic
1085283989 11:75348339-75348361 CCAGGCAGGGAGCATGGTACAGG - Intronic
1085298539 11:75444817-75444839 CCAGGCACTGAGCTAGACACTGG + Intronic
1085773428 11:79344415-79344437 CCAGAGAATGAGAAAGACACAGG + Intronic
1086076511 11:82859034-82859056 CCAGGCATTGTGCCAGACACTGG + Intronic
1086140999 11:83500191-83500213 CCAGGCATTGTGCTAGGAACTGG - Intronic
1086141249 11:83503011-83503033 CCAGGCACTGTGCTAGGAACTGG + Intronic
1086207066 11:84271638-84271660 CCAGGCACTGTGCTAGACACTGG + Intronic
1086430125 11:86728915-86728937 CCAGGCATTGTGCAAAGTACTGG - Intergenic
1086667387 11:89499797-89499819 CCAGGCATTGTGCTAGGCCCTGG - Intergenic
1087045871 11:93843412-93843434 CCAGGCACTGTGCTAGGCCCTGG - Intronic
1087149923 11:94850211-94850233 CCAGGCTTTGAGCAACGCCCAGG + Exonic
1087345055 11:96961646-96961668 CCAGGCACTAAACCAGGCACTGG + Intergenic
1087789529 11:102391833-102391855 CCAGGGAATGAGCACGGCCCAGG - Intergenic
1088236583 11:107731578-107731600 CCAGGCACTATGCCAGGCACTGG - Intergenic
1088701327 11:112415041-112415063 CCAGGCAATGTTCAAGGTGCTGG - Intergenic
1089401018 11:118164770-118164792 CCAGGCACTGTGCCGGGCACTGG - Exonic
1089663704 11:120002956-120002978 CCAGACAGTGTGCAAAGCACTGG + Intergenic
1089765313 11:120758894-120758916 CCAGGCACTGTGCTAGGCACTGG + Intronic
1089789456 11:120932262-120932284 CCAGGCAGTGTGCAAGGTGCTGG - Intronic
1090295864 11:125587593-125587615 TCAGGTACTGAGCAAGGGACTGG + Intergenic
1090990448 11:131812530-131812552 CCAGGCATTGTGCTAGGGACTGG + Intronic
1091491546 12:936977-936999 CAAGGCAAGCAGCAAGCCACGGG - Intronic
1091716905 12:2784073-2784095 CCAGGCTCTGTGCCAGGCACTGG - Intergenic
1092173687 12:6388966-6388988 CCAGGCACTGTCCTAGGCACTGG + Intronic
1092534935 12:9378846-9378868 CCAGGCTCTGTGCTAGGCACTGG + Intergenic
1092746414 12:11676443-11676465 CAAGACAAAGAGCAAGGGACAGG - Intronic
1092926265 12:13275256-13275278 CCAGGCACTGTTCTAGGCACTGG - Intergenic
1093006415 12:14056397-14056419 CCAGGCAATGTGCTAAGCACTGG + Intergenic
1093354621 12:18151533-18151555 CCAGGCATTGTGAAAGGTACTGG + Intronic
1094062182 12:26326119-26326141 CCAGGCACTGAGCAAGGCACTGG - Intergenic
1094221268 12:27996152-27996174 CCAGGCACTGTTCAAGGTACTGG - Intergenic
1094574394 12:31670776-31670798 CCAGGCACTGTTCTAGGCACTGG + Exonic
1095086225 12:38059739-38059761 CCACGAAATGAGCCAGGTACAGG - Intergenic
1095486221 12:42687392-42687414 CCAGGCACTGTGCTAGGCAATGG + Intergenic
1095909319 12:47409808-47409830 CCAGGCATTGTTCTAGGCACTGG - Intergenic
1096314623 12:50553381-50553403 CCAGGCACTGCGCTAGGTACTGG - Intronic
1096604548 12:52755196-52755218 CCAGGCACTGTGCTAGGCAATGG - Intergenic
1096913173 12:55004411-55004433 CCAGGCATTGCTCCAGGCACTGG - Intergenic
1097079353 12:56418509-56418531 GCAGGCACTGTGCTAGGCACTGG - Intronic
1097260865 12:57719433-57719455 CCAGGCAGAGTGCTAGGCACTGG - Intronic
1097268124 12:57757287-57757309 CCAGGCACTGTTCTAGGCACTGG + Intronic
1097288459 12:57895223-57895245 CCTGGCACTGAGCTAGGCGCCGG - Intergenic
1097367385 12:58732122-58732144 CCAGGCACTGTGCTCGGCACTGG + Intronic
1097694648 12:62764650-62764672 CCAGGCACTGTACTAGGCACTGG + Intronic
1098301223 12:69056010-69056032 CCAGGCATTGTGCCAGGCTCTGG - Intergenic
1098364453 12:69687939-69687961 CCAGGCACTGTGCTGGGCACTGG - Intronic
1098394494 12:70003900-70003922 CCAGGCACTTGGCTAGGCACTGG + Intergenic
1098445031 12:70557732-70557754 CAAGGCAATGAGCCCAGCACAGG - Intronic
1098637312 12:72800428-72800450 CCAGGCAATATTAAAGGCACAGG - Intergenic
1098800042 12:74944825-74944847 CCAGGCACTGTTCTAGGCACAGG - Intergenic
1098979120 12:76936018-76936040 CCAGGCTCTGTGCTAGGCACTGG + Intergenic
1099315723 12:81079643-81079665 CCAGACAGTGAACAAGACACTGG + Intronic
1100792734 12:98148547-98148569 CCAGGCAGTGAGGCAGGTACTGG + Intergenic
1100938950 12:99703792-99703814 CCAGGCTTTGCGCTAGGCACTGG - Intronic
1101059388 12:100955103-100955125 CCAGGCATTGTGCCAGGCACTGG + Intronic
1101373485 12:104151390-104151412 CCAGGCACTGTTCTAGGCACAGG - Intergenic
1101530887 12:105572789-105572811 CCAGACACTGACCAGGGCACTGG + Intergenic
1101590997 12:106125253-106125275 CCAGGCACTGAACTAGGCACTGG + Intronic
1101833679 12:108279770-108279792 GCAGGCAATGTGCTAGGCTCTGG - Intergenic
1101983187 12:109425463-109425485 GCAGGCACTGTGCCAGGCACAGG + Intronic
1101997423 12:109534969-109534991 CCAGGTGATGCCCAAGGCACAGG + Exonic
1102221421 12:111197445-111197467 CCAGGCACTGTTCCAGGCACTGG - Intronic
1102510978 12:113415183-113415205 CCAGGCACTGTTCTAGGCACTGG - Intronic
1102521890 12:113482845-113482867 CCAGGTACTGAGCTAGGCATTGG - Intergenic
1103142278 12:118559141-118559163 CCAGGCGTTGTGCTAGGCACTGG - Intergenic
1103179836 12:118900823-118900845 CCAGGCACTGAGCTAGCTACTGG + Intergenic
1103325169 12:120115684-120115706 CCAGGCACTGTTCTAGGCACTGG + Intronic
1103446534 12:120998771-120998793 CCTGTCAAAGAGCAAGGCAGAGG - Intronic
1103571836 12:121850017-121850039 CCAGGCACTGAGCTTGGCGCTGG - Intronic
1104162391 12:126192458-126192480 CTAGGCAAGGAGCATGGGACAGG + Intergenic
1104545444 12:129708475-129708497 ATAGGCATTCAGCAAGGCACAGG - Intronic
1104632325 12:130413996-130414018 GCAGGCCATGGGCGAGGCACGGG - Intronic
1105579647 13:21683312-21683334 CCAGGCACTGTGCTAGGAACTGG - Intronic
1106370007 13:29122955-29122977 CCAGGCATGGAACTAGGCACTGG - Intronic
1107689152 13:42934673-42934695 CCAGGTACAGAGCAAAGCACAGG - Intronic
1107695319 13:42993879-42993901 GTAGGCAATGTGGAAGGCACAGG + Intergenic
1107723345 13:43272930-43272952 GCTGGCAATTAGCAAGGCACTGG - Intronic
1108596062 13:51950561-51950583 CCAGGCACTGTTCTAGGCACTGG + Intronic
1108668983 13:52662544-52662566 CCAGGCAGTGTTCTAGGCACTGG - Intronic
1109192228 13:59339129-59339151 CCAGGCATTGGGCTATGCACTGG - Intergenic
1109319370 13:60790945-60790967 CTAGGCCATGAACAAGACACAGG + Intergenic
1110424300 13:75348448-75348470 CCAGGCAATGTGCTAGGCACTGG - Intronic
1112193716 13:97203803-97203825 CCAGGCAATGTTCTAGGCATTGG - Intergenic
1113024841 13:105929142-105929164 CCAGGCAATGTGCCAGGCTTGGG - Intergenic
1113208229 13:107941963-107941985 CCTGGCAATGAGCAAGGTAAGGG - Intergenic
1113339683 13:109409800-109409822 CAAGGGAATGAGCCAGGCAGGGG + Intergenic
1114054871 14:18959190-18959212 AAAGGAAATGAGCCAGGCACAGG - Intergenic
1114107670 14:19442587-19442609 AAAGGAAATGAGCCAGGCACAGG + Intergenic
1114339127 14:21724510-21724532 CCAGGTACTGGGCAAAGCACCGG + Intergenic
1114413589 14:22523472-22523494 CCAGGGAATTAGCAAAGAACTGG + Intergenic
1114686301 14:24535015-24535037 CCAGGCACTGTGCTAGGCACTGG - Intergenic
1114887564 14:26872925-26872947 CAAGGCACTGAGCAAGGGAATGG + Intergenic
1115378632 14:32707611-32707633 CCAGGCACTGTGCTTGGCACTGG - Intronic
1117785724 14:59282317-59282339 CCAGGCATTGTGATAGGCACAGG - Intronic
1117964749 14:61195450-61195472 TCAGGCAATGTGCTAGTCACTGG + Intronic
1118182835 14:63510340-63510362 CCAGGCACTGTTCTAGGCACTGG + Intronic
1118714800 14:68551470-68551492 CCAGGCAGAGAGGAAGGCAGGGG - Intronic
1118750565 14:68805098-68805120 CTAGGCACTAAGCCAGGCACTGG - Intergenic
1118911759 14:70067501-70067523 CCAGGCACTGTGCTGGGCACTGG - Intronic
1118924214 14:70177146-70177168 CCAGGCACTGATTTAGGCACTGG - Intronic
1119416484 14:74473706-74473728 CCAGGCACTGTGCTGGGCACTGG - Intergenic
1119420000 14:74502844-74502866 CCAGGCTATGAGTATGGCCCCGG - Exonic
1119440080 14:74622260-74622282 TCAGGCACTGTGCTAGGCACGGG + Intergenic
1119641238 14:76316505-76316527 CCAGGCACTGCACTAGGCACTGG - Intronic
1120048929 14:79842383-79842405 CCAAGCACTGAGCAAGGCAAGGG + Intronic
1120963826 14:90149900-90149922 CCAGGCATTGTGCTAGGCACTGG + Intronic
1121390993 14:93574399-93574421 CCAGGCACTGAAATAGGCACTGG + Intronic
1121735626 14:96216208-96216230 CGAGGCAGTGACTAAGGCACAGG - Intronic
1121744752 14:96279457-96279479 CAAGGCACTGTGCTAGGCACCGG + Intergenic
1121838616 14:97114592-97114614 GCAGGCACTGTGCAAGGCACAGG - Intergenic
1121858066 14:97288737-97288759 CCAGGCACTGGACAAGGCAAAGG - Intergenic
1122102026 14:99420303-99420325 TGAGGCACTGAGCAAGGCACTGG - Intronic
1122142728 14:99672517-99672539 CCAGGCACAGTGCTAGGCACAGG - Intronic
1122193777 14:100069114-100069136 CCAGGCAATGTTTTAGGCACTGG - Intronic
1122795722 14:104205252-104205274 ACAGGCAGTGAGCCAGGCAGGGG + Intergenic
1123061124 14:105594952-105594974 CCAGGCCATGTGGAAGGCAGGGG + Intergenic
1123085579 14:105715863-105715885 CCAGGCCATGTGGAAGGCAGGGG + Intergenic
1123699112 15:22901692-22901714 CCAGGCAACGAGCAAAGTCCTGG + Intronic
1123997638 15:25729878-25729900 CCAGGCTCTGAGGTAGGCACTGG - Intronic
1124014855 15:25865566-25865588 CCCGGCAATGTTCCAGGCACAGG + Intergenic
1124238269 15:28008071-28008093 CCAGGCAGTGTCCAAGGCACTGG + Intronic
1124392767 15:29274584-29274606 CCAGGCACTGTGCTAGGTACTGG - Intronic
1124407918 15:29408205-29408227 CCAGGCACTGTTCTAGGCACAGG + Intronic
1126166583 15:45658955-45658977 GCAGGCAAAGAGCTGGGCACGGG - Exonic
1126417822 15:48436773-48436795 CCAGGCACTGTGCTAGGCTCTGG - Intronic
1127320640 15:57841810-57841832 CCAGGCAATAAGCATGCTACTGG + Intergenic
1127602521 15:60552514-60552536 TCAGGCACTGAGGCAGGCACTGG - Intronic
1127912340 15:63427834-63427856 CCAGGGACTGAGCAAGGCGGAGG + Intergenic
1128265202 15:66260075-66260097 CCAGGCACTATGCAAGACACTGG - Intergenic
1128317475 15:66670172-66670194 CCAGGCAATCAGCCGGCCACTGG - Intronic
1128732440 15:70030419-70030441 CCAGGCAGTGAGCAATGCAGGGG - Intergenic
1128901543 15:71427237-71427259 CCATACACTGGGCAAGGCACTGG + Intronic
1128901546 15:71427249-71427271 CAAGGCACTGGGCAAGGCACTGG + Intronic
1128917137 15:71573207-71573229 TCAGGCACTGTGCAAGGCCCTGG - Intronic
1128933801 15:71728406-71728428 CCAGGCAATGATCCAGGCCCTGG - Intronic
1129042855 15:72705233-72705255 CCAGGCACTGTTCTAGGCACTGG - Intronic
1129185854 15:73906006-73906028 CCAGGCTCTCAGCAAGGGACTGG + Intergenic
1129920898 15:79318344-79318366 CCAGGCACTGTGCTAGGCCCAGG - Intronic
1129999206 15:80032697-80032719 TCAGGCACTGAGTCAGGCACTGG - Intergenic
1130558262 15:84938586-84938608 CCAGGCATTCTGCTAGGCACTGG + Intronic
1130975744 15:88772819-88772841 CCAGGGAATGAGTAAGGAAGGGG + Intergenic
1131252603 15:90840098-90840120 CCAGGCACTGTGCCGGGCACTGG - Intergenic
1132175203 15:99708658-99708680 GCAGGCACTGTGCCAGGCACTGG + Intronic
1133206062 16:4234417-4234439 ACAGACAATGAGGAAGTCACAGG + Intronic
1133476484 16:6126790-6126812 CCAGGTAATGAGCTAGGAGCTGG + Intronic
1133970862 16:10567221-10567243 CCAGGCACTGTGCTGGGCACGGG - Intronic
1134317665 16:13134386-13134408 CCTGACAATGTGCAAGGGACTGG + Intronic
1134398867 16:13890245-13890267 CCAGGCAATATTCTAGGCACAGG + Intergenic
1134773589 16:16832368-16832390 CCAGGCACCATGCAAGGCACTGG + Intergenic
1134805999 16:17125976-17125998 CCAGGCACTGTACAAGGCCCTGG + Intronic
1135114907 16:19716193-19716215 CCAGGCACTGAGCAGGACACTGG - Intronic
1135201324 16:20439995-20440017 CCAGGCCCTGTGCCAGGCACTGG + Intronic
1135217784 16:20587869-20587891 CCAGGCCCTGTGCCAGGCACTGG - Intergenic
1135481703 16:22826090-22826112 CCAGGCAATGTGCTAAGCCCTGG + Intronic
1135547066 16:23373653-23373675 CCAGACACTGAGGCAGGCACTGG - Intronic
1135714607 16:24751709-24751731 CCAGGCATTGTGCTAGGAACTGG + Intronic
1137529979 16:49273186-49273208 CCTGGCACTGAGCTAGGCATTGG + Intergenic
1137558422 16:49488042-49488064 CCAGGCACTGCACAGGGCACTGG - Exonic
1137600711 16:49754329-49754351 CCAGGCACTGTGCTAGGCATCGG - Intronic
1137859493 16:51831869-51831891 CCAGGCACTGTGATAGGCACAGG - Intergenic
1137866229 16:51899392-51899414 CCAGGCACTGTGCCAGGCTCTGG - Intergenic
1138375800 16:56563254-56563276 CCAGGCACTGTGCTGGGCACTGG - Intergenic
1138531486 16:57636760-57636782 CCAGGCACTGTGCTAGGTACTGG + Intronic
1138556999 16:57776643-57776665 CCAGGCACTGTTCCAGGCACTGG - Intronic
1139247879 16:65463984-65464006 CCAGGCAAAGAGCAAGACCAGGG - Intergenic
1139284655 16:65800041-65800063 CCAAGCAATGAGCAGGGCTCTGG + Intergenic
1139314877 16:66059605-66059627 CCAGGCACTGTGCTGGGCACTGG - Intergenic
1139363164 16:66416071-66416093 CCAGGCACTGTGCTGGGCACAGG - Intergenic
1141284558 16:82659648-82659670 CCAGGTACTGTGCGAGGCACTGG + Intronic
1141289685 16:82706216-82706238 CCAGGCACGATGCAAGGCACTGG + Intronic
1141595536 16:85094869-85094891 CCGGGGAAGGAGCAGGGCACAGG + Intergenic
1141810090 16:86370231-86370253 CCTGGCAATGTGCCAGGCAGAGG + Intergenic
1142594316 17:1022238-1022260 CCAGGCCCTGAGCCAGGCATCGG + Intronic
1142680982 17:1548491-1548513 CCATGCAATGAGCAGGTTACTGG + Intronic
1142740526 17:1929320-1929342 CCTGGCCATGTGCAAGGCCCCGG - Intergenic
1143011652 17:3869416-3869438 CCAGGCACAGAGCAAGGCTCAGG + Intronic
1143407381 17:6686433-6686455 CCAGGGACAGAGCATGGCACAGG - Intronic
1143774477 17:9188901-9188923 CCAGTAATTGACCAAGGCACTGG + Intronic
1143787326 17:9265716-9265738 CCAGGCACTGTTCTAGGCACTGG + Intronic
1143847969 17:9787424-9787446 CGAGGCACTGAGCACGCCACTGG - Intronic
1143971919 17:10802104-10802126 TCAGGCACTGTGCAAGACACTGG - Intergenic
1144074674 17:11706355-11706377 CCAGACACTGAACAAGTCACTGG + Intronic
1144205450 17:12976650-12976672 CCAGGAAATGACAAAGGGACAGG + Intronic
1144809636 17:17990439-17990461 CCAGGCACTGAGCAAAGGCCAGG - Intronic
1145260845 17:21353626-21353648 CCAGGCACTGTGCTGGGCACTGG + Intergenic
1145408088 17:22626651-22626673 CCAGGCACTGGGCTAGGCAAAGG - Intergenic
1145959903 17:28881278-28881300 CGAGGCGATGGGCAAGGCAGAGG - Exonic
1146024700 17:29309493-29309515 CCAGGCACTGTGCTAGGCTCTGG - Intergenic
1146027260 17:29332262-29332284 CCAAGCAATGAGCTAGGTGCTGG - Intergenic
1146455539 17:33006683-33006705 CCAGGCACTGAGTTAGGTACTGG - Intergenic
1146597430 17:34182767-34182789 CCAGTCAATCACCAAGTCACAGG + Intergenic
1146660132 17:34660007-34660029 CCAGGCACTGAACTAGGCATGGG + Intergenic
1146923089 17:36726854-36726876 CCAGGCATTGTGCTAGGCTCGGG + Intergenic
1147041423 17:37722317-37722339 CCAGGCACTGTGCTTGGCACTGG + Intronic
1147138392 17:38448018-38448040 GCAGGCAAGGAGCATGGCAAAGG - Intronic
1147547480 17:41413751-41413773 CCAGGCTTTGTGCAAGACACTGG + Intergenic
1147776732 17:42907278-42907300 CCAAGCATTGTGCAAGGCTCTGG - Intronic
1147928027 17:43957262-43957284 CCAGGCACTGATCTAGGCACTGG + Intronic
1147972630 17:44227773-44227795 GGAGGCACTGAGCAAGGGACAGG + Intergenic
1148019114 17:44541974-44541996 CCGGGCAGTGAGAAAGGCACCGG - Intergenic
1148355712 17:46974278-46974300 CTAGGCACTGTGCCAGGCACTGG - Intronic
1148644998 17:49214791-49214813 CTAGGCACTGTGCCAGGCACTGG - Intronic
1148704947 17:49621795-49621817 CCAGGCACTGTGCTAGGCACTGG + Intronic
1149543741 17:57487987-57488009 CCTGGCACAGAGCTAGGCACTGG - Intronic
1150597174 17:66616509-66616531 CCAGGCACCGTGCTAGGCACTGG + Intronic
1151219500 17:72601971-72601993 CCAGGTACTGTGCTAGGCACTGG + Intergenic
1151285393 17:73107460-73107482 CCAGGGAATGGGGAAGGAACGGG + Intergenic
1151355248 17:73554193-73554215 CCTGGCATTGCGCAAAGCACTGG - Intronic
1151379943 17:73718929-73718951 CCAGGCACTGTTCAAAGCACTGG + Intergenic
1151889884 17:76945801-76945823 CCAGGCACTGTGCCAGGCACTGG + Intronic
1152048520 17:77954984-77955006 TCAGACAAGCAGCAAGGCACAGG - Intergenic
1153355045 18:4125144-4125166 CCAGGCATTATGCCAGGCACTGG + Intronic
1154360470 18:13656425-13656447 CAAGGCAAAGACCAAGTCACTGG + Intergenic
1155184165 18:23372843-23372865 TCAGGCACTGAGCCAGGCTCTGG - Intronic
1156091991 18:33482549-33482571 CCAGGCAGTGAGCATGGTACTGG + Intergenic
1156184903 18:34651569-34651591 CCAGGCATTGAGCTATGTACTGG + Intronic
1156192111 18:34731752-34731774 CCAGGCACTGTACAAGGCACTGG - Intronic
1157553506 18:48597570-48597592 CCAGGGCAGGAGCAAGGCAGGGG - Intronic
1157728231 18:49981643-49981665 CCAGGCAGTGTTCAAGGCCCTGG - Intronic
1157784106 18:50466774-50466796 CCAGACATTGTGCCAGGCACTGG + Intergenic
1157875675 18:51271064-51271086 CCAGGCAATGTGCTAGACGCTGG - Intergenic
1158130940 18:54151977-54151999 CCAGGCACTGGGCTAGGCTCGGG + Exonic
1158317436 18:56227211-56227233 CCAGGCACTGATTAAGGTACTGG + Intergenic
1158531328 18:58265033-58265055 GCAGGCACTAAGCAAGGCATTGG + Intronic
1158537454 18:58321080-58321102 CCAGGCAATGTTCTTGGCACCGG + Intronic
1158537545 18:58322080-58322102 ACAGGCATATAGCAAGGCACTGG + Intronic
1160232806 18:77060996-77061018 CCAGGCTCTGAGAAAGGCCCAGG - Intronic
1160799619 19:961583-961605 CCAGGCACTGTACCAGGCACGGG - Intronic
1160861496 19:1238946-1238968 ACAGGCAAGGCGCAAGGCATAGG - Intergenic
1161166797 19:2791982-2792004 CCAGGCATTCAGCAGAGCACAGG - Intronic
1161951614 19:7470870-7470892 TCAGGGAATGAGCCAGGCACGGG + Exonic
1163157499 19:15447524-15447546 CCAGGGTATGTGCTAGGCACTGG - Intronic
1164494496 19:28746969-28746991 TCAGACATTGAGCTAGGCACTGG - Intergenic
1164538429 19:29104194-29104216 CCAGCCACTGAGCCAGACACCGG + Intergenic
1164846682 19:31438561-31438583 CCAGGCAATAAGCAATGGCCAGG - Intergenic
1165268057 19:34677920-34677942 CCAGGAAATGCCCAAGGCCCCGG - Exonic
1165398771 19:35584169-35584191 CCAGGCAGTGAGCAAGAAAGGGG - Intergenic
1165432668 19:35781449-35781471 CCAGGCACTGTTCTAGGCACTGG + Intronic
1165973986 19:39658214-39658236 TCAGGGAATGAACAAGTCACAGG + Intronic
1166001575 19:39880589-39880611 CAAGGCAAAGACCAAGGCTCTGG + Intronic
1166137868 19:40788103-40788125 CCAGGCCCTGCTCAAGGCACTGG + Intronic
1166965266 19:46526111-46526133 CCAGGCACTGTCCTAGGCACTGG - Intronic
1166985212 19:46655735-46655757 CCAGGCACTGTTCTAGGCACTGG - Intronic
1167002198 19:46752461-46752483 CCAGGCACTGTTCTAGGCACTGG - Intronic
1167535442 19:50048023-50048045 CCAGGCAATTTGCTAGGCTCGGG + Exonic
1168340063 19:55617578-55617600 CCAGGCCCTGAGCTGGGCACTGG + Exonic
925214861 2:2085651-2085673 CCAGGCAATGAATGAAGCACTGG - Intronic
925379927 2:3417595-3417617 CCAGGCACTGTGCTAGGCTCGGG - Intronic
926677915 2:15642081-15642103 CCAGGCACAGAGCAAAGCACTGG - Intergenic
927200545 2:20575591-20575613 CCAGGTGAGGAGCCAGGCACTGG + Intronic
928375417 2:30769583-30769605 CCAGGCACTGTGCTTGGCACTGG - Intronic
928427653 2:31192330-31192352 CCAGGCACTGAGCAAGACAAAGG - Intronic
928735009 2:34278284-34278306 CCAGGCACTAAGCTAAGCACTGG - Intergenic
929576381 2:43055345-43055367 AGGGGCAATGAGCAAGACACAGG + Intergenic
930671942 2:54160536-54160558 CCAGGTACTGTGCAAGGCACTGG - Intronic
930695777 2:54410629-54410651 CTAGGCACTGAGCTAGGCAAAGG + Intergenic
931257118 2:60583437-60583459 CCAGGCACTGATGGAGGCACTGG - Intergenic
931582229 2:63789379-63789401 CCAGGTTCTGAGCCAGGCACTGG - Intronic
932420036 2:71596210-71596232 CCAGGCAATGAGCTCAGCGCTGG - Intronic
933376040 2:81481428-81481450 CCAGGCACTGACGTAGGCACTGG + Intergenic
933470568 2:82717648-82717670 TCACCCAATGAGAAAGGCACTGG - Intergenic
933724968 2:85421409-85421431 ACAGGAAATGGGCAAGACACGGG + Intronic
933761640 2:85676335-85676357 CCAGGCACTAATCTAGGCACTGG + Intergenic
933982386 2:87562332-87562354 GAAGTCCATGAGCAAGGCACTGG + Intergenic
934567833 2:95350405-95350427 CCAGGCACTGTTCTAGGCACAGG - Intronic
935043379 2:99456263-99456285 CCAGGCAAGGTTCTAGGCACTGG + Intronic
935206787 2:100903177-100903199 CCAGGGCATGAGCAAGGACCCGG - Intronic
935229113 2:101080653-101080675 AGAGGCAAGGAGCAAGCCACAGG - Intronic
935311823 2:101791709-101791731 CCCAGCAAAGAGCAAGGCAAAGG - Intronic
936156125 2:110048427-110048449 CCAGGCAGACAACAAGGCACAGG + Intergenic
936485895 2:112925497-112925519 CCAGGCCATCAGCAATGCCCAGG + Intergenic
936687315 2:114842908-114842930 CTAGGCTTTGAGCAAGGGACAGG + Intronic
936993263 2:118387945-118387967 TCAGGCCCTGAGCTAGGCACTGG + Intergenic
937013414 2:118581996-118582018 ACAGGCACTGTGCTAGGCACCGG - Intergenic
937065502 2:119013822-119013844 CCAGGCACTGTGCCAGGTACTGG + Intergenic
937242310 2:120470220-120470242 CCAGGCATTGTGTAAGGCACTGG - Intergenic
937375782 2:121334863-121334885 CCAGGCACTTGGCAGGGCACAGG + Intergenic
937647476 2:124281988-124282010 CCAGGCAAAGAGGAAAGGACAGG - Intronic
937648217 2:124289780-124289802 AGAGGCAAAGAGCATGGCACAGG - Intronic
938587704 2:132707622-132707644 CCAGGCACTGTTCTAGGCACTGG + Intronic
940051886 2:149473677-149473699 CCAGGTTATGTACAAGGCACTGG + Exonic
940368631 2:152876618-152876640 CCAGGCATTGTGCAAGGCACTGG - Intergenic
940771374 2:157842430-157842452 CCAGGCACTGATTTAGGCACTGG + Intronic
941469093 2:165862311-165862333 CCAGGCACTGTGCCAGGCAGAGG - Intronic
941486448 2:166087770-166087792 ATAGACAATGTGCAAGGCACTGG + Intronic
942117054 2:172738291-172738313 CCAGGCACTGTGCTGGGCACTGG + Intronic
942493091 2:176509551-176509573 GCAGGCCATGTGCTAGGCACGGG - Intergenic
942516448 2:176758246-176758268 CCAGGCACTGAACAAGGTCCTGG + Intergenic
942632317 2:177963986-177964008 CCAGGCATTGTGCTAGGCACTGG - Intronic
943266358 2:185738199-185738221 CCAGTCATTGAGCTAAGCACTGG - Intergenic
944066867 2:195628498-195628520 CCGGGCACTGTGCTAGGCACTGG + Intronic
944228135 2:197368426-197368448 CCAGGCCAAGAGAAAGGCAAGGG + Intergenic
945094560 2:206206706-206206728 CCAGGCACTGTGCTAGGCTCTGG - Intronic
945098936 2:206246200-206246222 CCAGGCACTGTGCTAGGCTCTGG + Intergenic
945243824 2:207700049-207700071 CCAGGCAGGGAGCTAGGTACTGG - Intergenic
945592407 2:211750187-211750209 CCAGGCACTGTTCCAGGCACAGG - Intronic
945722059 2:213429410-213429432 CCAGGCAATTAGCTAGGCCAGGG - Intronic
946007853 2:216540860-216540882 CCAGGCACTGTGCTAGGCACTGG - Intronic
946095883 2:217273775-217273797 CCAGGCATTGTGCAGGGCAGTGG - Intergenic
946704797 2:222447768-222447790 CCAGCCACTGAGCTAGGCACTGG + Intronic
947107557 2:226683401-226683423 CCAGGCACAGGGCAAGGCAGGGG + Intergenic
947186975 2:227464061-227464083 CCAGGCACTGTGCCAGACACTGG - Intergenic
947430413 2:230023218-230023240 CCAGGCACTGAGCTAAGCCCTGG + Intergenic
947567609 2:231204596-231204618 CCAGGCACTGGTCTAGGCACAGG + Intronic
947796863 2:232898718-232898740 CCAGGCACTGGTCTAGGCACTGG + Intronic
948185784 2:236020226-236020248 CTAGGCAAGGAGCAATGCAGGGG - Intronic
948262774 2:236616361-236616383 CCAGGCACTGTGCTAGGTACAGG + Intergenic
1168913098 20:1466062-1466084 CCAGGCATTGTTCCAGGCACTGG + Intronic
1169264901 20:4161775-4161797 CCAGGCACTGTCCGAGGCACTGG - Intronic
1169754063 20:9024632-9024654 CCAGGCACTGTTCTAGGCACTGG - Intergenic
1170099750 20:12686012-12686034 CCAGACACTGTGCTAGGCACTGG - Intergenic
1170640149 20:18144871-18144893 CCAGGCACTGGGCTAGGAACTGG - Intronic
1171109107 20:22464222-22464244 CAATGCAATGAACAAGGCAAGGG + Intergenic
1172511506 20:35504162-35504184 CCAGGCAGTGCTCAAGGAACGGG + Exonic
1172536524 20:35677923-35677945 CCAGGCATTGGGCCGGGCACGGG + Intronic
1172641238 20:36441598-36441620 CCAGGCACTGTGCCAGGTACTGG - Intronic
1172991595 20:39040823-39040845 TCAGGCCATGTGCATGGCACAGG + Intergenic
1173342217 20:42162715-42162737 CCAGGGAATGAGTATGGCATAGG - Intronic
1173401698 20:42731656-42731678 CCAGTCAAAGAGCAGAGCACAGG - Intronic
1173585932 20:44183249-44183271 CCAGGCACAGTGCTAGGCACTGG - Intronic
1173826425 20:46050693-46050715 CCAGGCACTGGGCGAGGCACAGG + Intronic
1173926055 20:46782168-46782190 CCAGGCTCTGACCCAGGCACTGG + Intergenic
1174077150 20:47945788-47945810 CCAGGCGCTGTGCTAGGCACTGG + Intergenic
1174419050 20:50387547-50387569 CCAGGCACTGGGCAAGGCTCTGG - Intergenic
1174430738 20:50466800-50466822 CCAGGCAGTGTTCTAGGCACTGG - Intergenic
1174498353 20:50965639-50965661 GCAGGCGATCAGCTAGGCACAGG + Intergenic
1174573428 20:51520504-51520526 CCAGGCACTGTGCTAGTCACTGG - Intronic
1174834050 20:53839484-53839506 CCAGGCACTGTGCTAGTCACTGG + Intergenic
1175504449 20:59471622-59471644 CCAGGCACTGTTCCAGGCACTGG + Intergenic
1176811825 21:13547709-13547731 CCAGGCACTGTGCTATGCACTGG + Intergenic
1177112894 21:17049678-17049700 CCAGAGAGTGAGCAAGGCAGAGG + Intergenic
1177748135 21:25246067-25246089 TCAAGCAATGTGCAAGGCAGTGG - Intergenic
1178022246 21:28422288-28422310 CCAGCCATGGAGCAAAGCACTGG - Intergenic
1178938972 21:36889082-36889104 CCAGGCACTGTGTTAGGCACTGG - Intronic
1179279836 21:39924989-39925011 ACAGGGAAAGAGGAAGGCACAGG - Intronic
1179464099 21:41560211-41560233 CCACGCTCTGGGCAAGGCACTGG + Intergenic
1180473354 22:15681740-15681762 AAAGGAAATGAGCCAGGCACAGG - Intergenic
1180676035 22:17587217-17587239 CCAGGCAATGAGGGTGGCAGAGG - Exonic
1180704320 22:17799595-17799617 CCAGGCCAGGAGCATGGCATTGG - Intronic
1181161684 22:20963521-20963543 ACAGGCACAGAGCCAGGCACAGG - Intergenic
1181755579 22:25022073-25022095 CCATGCAAAGAGCCAGGAACGGG - Intronic
1181787308 22:25236512-25236534 CCAGGCACACAGCAAGGCCCTGG + Intergenic
1181972102 22:26698680-26698702 CCAGGAACTGGGCGAGGCACTGG - Intergenic
1182070531 22:27460440-27460462 CCATGCAATGAGGAAAGCTCAGG - Intergenic
1182076152 22:27496777-27496799 CCAGGCACTGTGCAAGAAACAGG - Intergenic
1182144504 22:27988988-27989010 TCAGGCAATGTTCCAGGCACTGG - Intronic
1183104036 22:35603310-35603332 CCAGGCACTGAGCTAGGCTCTGG - Intergenic
1183238940 22:36641298-36641320 CCAGGCACTGTGCTAGGTACTGG - Intronic
1184094646 22:42309975-42309997 CCAGGCCCTGTGCAGGGCACTGG - Intronic
1184150822 22:42637531-42637553 CGAAGCACTGAGCCAGGCACTGG + Intronic
1184432532 22:44449867-44449889 CCAGGCTCTGGGCCAGGCACTGG - Intergenic
1185060952 22:48606739-48606761 CCAGGTAAGGAGCCAGGCAGGGG - Intronic
949179649 3:1113025-1113047 CCAGGCAATGCATTAGGCACTGG + Intronic
949870391 3:8583106-8583128 CCAGGCACTGATCAAGGTGCTGG - Intergenic
949870514 3:8583974-8583996 CCAGGCAGTGTGCTAGGCTCTGG - Intergenic
949940707 3:9152127-9152149 CCAGGCAATGTTCTAGGTACAGG - Intronic
950107757 3:10398995-10399017 CCAGCCAAGGAGGAGGGCACAGG - Intronic
950151868 3:10693770-10693792 CCAGGCAGTGTGCCAGGCTCTGG - Intronic
950236986 3:11331098-11331120 CCAGGCACAATGCAAGGCACAGG + Intronic
950276493 3:11665727-11665749 CCAGGCACTGTGCTAGGCACTGG + Intronic
950683401 3:14600879-14600901 CCTGGCATTGAGGAAGGCATTGG + Intergenic
951850092 3:27129711-27129733 CCAGGCACTGTGCAAGGCCCTGG + Intronic
952073156 3:29663861-29663883 CCAGGCACTGTTCAAGACACTGG - Intronic
952189041 3:31002617-31002639 CCAGGGAAATAGCAAGGCATTGG - Intergenic
952662079 3:35863937-35863959 CCAAGCCATGACCAAAGCACTGG - Intergenic
952769266 3:36982934-36982956 CCAGGCACTGATCTAGGCACTGG - Intergenic
952858384 3:37792258-37792280 CCAGGCACTGTGCTAGGCACTGG + Intronic
952988314 3:38807904-38807926 CCAGTTAATGAGCAAGTCTCTGG - Intergenic
953142779 3:40245045-40245067 CCAGGTATTGTGCTAGGCACTGG - Intronic
953328660 3:42033985-42034007 CCAGGCTATGACCAGGGCAGTGG - Intronic
953411845 3:42694998-42695020 CCAGGCATTGTTCTAGGCACTGG - Intronic
953737763 3:45510901-45510923 CCTGGCACTGAGCTAGGCACTGG - Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954908804 3:54086130-54086152 CCAGGCCCTGTGCTAGGCACTGG - Intergenic
955090214 3:55743214-55743236 TCATGCACTGAGCAAGGAACAGG - Intronic
955162115 3:56473909-56473931 CCAGGGAATGAGGAAGGAAGAGG - Intergenic
955240438 3:57173470-57173492 CCAGGCACTGTGCAAGGCACTGG + Intergenic
955644060 3:61117838-61117860 CCAGACACTGAGCTAGGCACTGG - Intronic
955645869 3:61136730-61136752 CCAGGCAATGTGTTAGGCTCCGG - Intronic
955863087 3:63353183-63353205 CCAGGCAGTGTGCAAGGCACTGG + Intronic
956464944 3:69510641-69510663 CCAGGCAACAAGCAAGCCAAAGG + Intronic
957600684 3:82331845-82331867 CCAGGAACTGAGAAAGTCACTGG + Intergenic
958906837 3:99951125-99951147 CCAAGCAGTGAGCACAGCACAGG - Intronic
959108491 3:102093744-102093766 CCAGGCTCTGAGCTAGGCACTGG - Intergenic
959581546 3:107988058-107988080 CCAGGCACTGTGTTAGGCACTGG - Intergenic
959650686 3:108747728-108747750 CCAGGCACTGTGCTATGCACTGG + Intronic
960908218 3:122622610-122622632 CTAGGCTCTGTGCAAGGCACTGG + Intronic
960989037 3:123298679-123298701 CCAGCCACTGAGCTAGGCAGTGG - Intronic
961076912 3:123991269-123991291 CCAGGCACTGGGCTAGGCACTGG - Exonic
961307670 3:125970041-125970063 CCAGGCACTGGGCTAGGCACTGG + Intronic
961528727 3:127526439-127526461 CCAGGCACTGGGCTAGGCATTGG + Intergenic
961554091 3:127685737-127685759 CCAGGCACTGAGCTGGGAACTGG - Intergenic
961555155 3:127692166-127692188 CCAGACCATGAGCCGGGCACCGG + Exonic
961728122 3:128946053-128946075 ACAGGCAATGAGCCTGGCACTGG - Intronic
962372491 3:134832345-134832367 CCAGGCTGGGAGCAAGGCAATGG + Intronic
962659150 3:137583630-137583652 CCAAGTATTGTGCAAGGCACGGG + Intergenic
964205244 3:154167237-154167259 CCAGGCACTGTGCTAGGCATTGG + Intronic
964739709 3:159952566-159952588 CCAGTCAATGTTCTAGGCACTGG + Intergenic
966165605 3:177013316-177013338 CCAGGCAGTGTGCTAGGCTCTGG + Intergenic
966310231 3:178586084-178586106 CGAGGCAAAGAGCAAGAGACAGG - Intronic
966375556 3:179291857-179291879 CCAGGCACTGCTCAAGGCTCAGG + Intergenic
966718538 3:183038077-183038099 CCAGGCTCTGATCCAGGCACTGG + Intronic
966784711 3:183612592-183612614 CCAGGCACAGAGCAAGGTGCTGG + Intergenic
966916297 3:184585906-184585928 CCAGGCACTGTGCTGGGCACTGG + Intronic
967527614 3:190513422-190513444 CCAGGCACTGTGCTAGGCAATGG + Intergenic
968297764 3:197590784-197590806 CCAGGCACTGTGCCAAGCACCGG - Intergenic
968316296 3:197728649-197728671 TCAGGCACTGGGCTAGGCACTGG + Intronic
968673190 4:1863374-1863396 TCAGGCGATGTGCAAGGCAGAGG + Intergenic
968823890 4:2878557-2878579 CCAGGCATTGTTCTAGGCACTGG + Intronic
968962024 4:3750518-3750540 CCAGGCCCTGGGCCAGGCACAGG + Intergenic
969193260 4:5541234-5541256 CCAGGCACTGTTCTAGGCACTGG + Intergenic
969201495 4:5609968-5609990 GCATGTAATGAACAAGGCACAGG + Intronic
969271329 4:6105358-6105380 CCAGGCATTGTTCAAAGCACTGG - Intronic
969291256 4:6241518-6241540 CCAGGCCCTGAGCTGGGCACTGG + Intergenic
969295593 4:6269216-6269238 CCAGGGAGTGGGCAAGGCTCAGG - Intergenic
969297714 4:6279567-6279589 CCAGGCACTGATCTAGGGACAGG - Intronic
969333883 4:6495401-6495423 CCAGGTACTGTGCCAGGCACCGG - Intronic
969409452 4:7018518-7018540 CCAGGCATGGGGCCAGGCACTGG - Intronic
969927543 4:10599189-10599211 CCAGGCATTGACCCAGGCCCTGG - Intronic
970149915 4:13078783-13078805 CCAGTCAATGTGCAAGACATTGG - Intergenic
970331288 4:14987006-14987028 CCTGGCACTCTGCAAGGCACTGG - Intergenic
970616108 4:17769814-17769836 CCAGGCACTGTTCTAGGCACTGG + Intronic
970970746 4:21980585-21980607 CCTGACAATGATCTAGGCACTGG + Intergenic
970978724 4:22072276-22072298 CCAGGGAGTGAGCTAAGCACTGG - Intergenic
972400197 4:38694524-38694546 CCAGGCACTGTGCTTGGCACCGG - Intronic
972848995 4:43025349-43025371 CCAGGCACTGTGTAAGGCAATGG - Intronic
973553390 4:52057538-52057560 CCAGGCACTGGGCAAGGCATAGG + Intronic
973712148 4:53640934-53640956 CCAGGGATTGAGGAAGGCCCCGG - Intronic
974578230 4:63757537-63757559 ACAGGCACTGTGCCAGGCACTGG + Intergenic
975459335 4:74631938-74631960 CCAGGCATTGAGCTAGGGACTGG - Intergenic
976345715 4:83997734-83997756 CCAGGCATTGTGCTAGGCATTGG - Intergenic
976629668 4:87223460-87223482 CCAGACACTGAGCTAGGAACTGG + Intronic
977569048 4:98611082-98611104 CCAGGCATGGAGGAAGGCAGAGG + Intronic
977573309 4:98652189-98652211 TCAGACAATGCGCAAGACACTGG + Intronic
978129000 4:105171206-105171228 CCAGGCACTGTGCTAGACACTGG - Intronic
979010885 4:115366506-115366528 CCAGGCACTGGCAAAGGCACTGG - Intergenic
979241686 4:118452769-118452791 CCAGGCACTGTTCTAGGCACTGG + Intergenic
979246014 4:118505461-118505483 CCAGGAAATGAGTAAGACTCAGG + Intergenic
981279133 4:142936836-142936858 CCAGGCACTGAACCAGGTACTGG + Intergenic
981391050 4:144192332-144192354 CCAGGCATTTTGCTAGGCACTGG + Intergenic
981690747 4:147506049-147506071 CCAGGGAAAGAGCAATGTACAGG - Intronic
982040020 4:151388177-151388199 CCAAGAAATGTGCAAGGCACTGG + Intergenic
982078544 4:151763399-151763421 CCAGCTAAGGAGCAAGGCAGGGG - Intergenic
983458632 4:167998014-167998036 ACAGACAATGAGGAGGGCACTGG + Intergenic
983853529 4:172613075-172613097 CCAGGCATTGTGCTAGACACTGG + Intronic
984360596 4:178725733-178725755 CCAGGTAAAGAGAAAGGCAAAGG + Intergenic
986322145 5:6640655-6640677 CCAGGCAAAGAACAAGGCTTTGG - Intronic
987110498 5:14681547-14681569 CCAGGCCATGAGCCAGGCTGTGG + Exonic
988111364 5:26826382-26826404 CCAGGCATTGATCTAGGCACTGG - Intergenic
988422729 5:31026085-31026107 CCAGGCACTGCGGAAGACACTGG + Intergenic
988466770 5:31499107-31499129 TCAGGTACTGAGCAAGGCAGAGG + Intronic
988623799 5:32849746-32849768 CCAGGCACTGTTCCAGGCACAGG - Intergenic
988939244 5:36125906-36125928 CCAGGCAAAGAGACAGGGACAGG + Intronic
989103731 5:37841911-37841933 CCAGGCAAAGTGCTAGGCCCTGG + Intergenic
989204192 5:38795396-38795418 CCAGGCACTGTGCTAGGCATGGG + Intergenic
989625104 5:43421869-43421891 CCAAGCACTGAGCGAGGCACTGG - Intergenic
989997776 5:50856004-50856026 CCAGGTACTGTGCTAGGCACTGG + Intergenic
990714727 5:58624138-58624160 CCAGGCACTGTGCCAGGCATTGG + Intronic
990974436 5:61546299-61546321 CCAGGCACTGTGCTAGGCCCTGG + Intergenic
991184444 5:63790872-63790894 CCAGGCACTGTGCTAGGCTCTGG - Intergenic
991561530 5:67958618-67958640 CCAGGCACTGTGTTAGGCACTGG + Intergenic
992139970 5:73786157-73786179 CCAGGCATTGTTCTAGGCACTGG + Intronic
992549387 5:77846742-77846764 CCGAGCAATTAGCAAGGCGCGGG + Intronic
992738827 5:79752158-79752180 CCAGGCATTGTGCTAGGTACTGG - Intronic
993352460 5:86867115-86867137 CCAGGCAATGGGCAAGGAAAGGG + Intergenic
993436672 5:87904216-87904238 CCAGGCACTGTGCAGGGCTCTGG + Intergenic
993698730 5:91093522-91093544 CCAGACCATGTGCTAGGCACTGG + Intronic
994230558 5:97306720-97306742 GCTAGCAATGAGCAAGGCTCTGG + Intergenic
994664503 5:102691600-102691622 CCAGACATTGTGCAAGGCAGTGG + Intergenic
995540616 5:113182759-113182781 CCAGGCCTTGTGCGAGGCACCGG - Intronic
995624344 5:114059997-114060019 CCAGGTAATTAGCTCGGCACTGG + Intergenic
996039286 5:118792558-118792580 CCAGGCAAAGGGCAAGTCACTGG + Intergenic
996343033 5:122458896-122458918 CCAGGCACCAAGCAAGACACTGG - Intronic
996893682 5:128454823-128454845 CCAGGTAATGTGAAATGCACAGG - Intronic
997426102 5:133803723-133803745 CCAGGCACTATGCTAGGCACTGG + Intergenic
998251741 5:140558072-140558094 CCAGGCACTAAGCTGGGCACTGG - Exonic
998299614 5:141005238-141005260 CCAGGAATTGTGCTAGGCACTGG + Intronic
998365856 5:141630301-141630323 CCAAGCCCTGTGCAAGGCACTGG + Intronic
998461894 5:142315855-142315877 CCAAGCACTGTGCCAGGCACTGG + Intronic
998665723 5:144295271-144295293 CCAGGCAGTATGCTAGGCACTGG - Intronic
998817302 5:146027462-146027484 CCAGGCACTGAGCTGGGCACAGG + Intronic
999143144 5:149376127-149376149 TCAGGCACTGAGCAAGGAAGCGG + Intronic
999480046 5:151939934-151939956 CCAGGCACTGAGATAGGCACTGG - Intergenic
999632776 5:153587735-153587757 CCAGGCAATGTGGTAGGCTCAGG + Intronic
999772204 5:154784203-154784225 CCAGGCCCTGAGCTAGACACTGG + Intronic
999825520 5:155269935-155269957 CCAGGCACTGTGCTAGGCCCTGG - Intergenic
999928101 5:156401638-156401660 CCAGGCACTGTGCAAGGTACTGG + Intronic
1000138790 5:158381233-158381255 CCAGGCACTGTGCTAGGCCCAGG - Intergenic
1000284934 5:159818917-159818939 CCAGACACTGTGCTAGGCACTGG + Intergenic
1000305152 5:159987828-159987850 CCAGGCAATGTGCAAGCCATTGG + Intergenic
1000321667 5:160139284-160139306 CCAGGCAGTGCTCAAGGCCCCGG + Intergenic
1001960285 5:175876222-175876244 CCAGTCAATGTGTTAGGCACTGG - Intronic
1002180430 5:177428335-177428357 TCAGGCCATGGGCAAGGCACAGG + Intronic
1002275802 5:178103747-178103769 CCAGTGACTGAGCAAGGCAGTGG + Intergenic
1002962749 6:1931891-1931913 CTAAGCACTGAGCTAGGCACTGG + Intronic
1003203835 6:3989430-3989452 CCAGGCATTGTGCTAGACACTGG + Intergenic
1003417097 6:5919595-5919617 CCAGGCAAAGAACAAGTGACAGG - Intergenic
1003665296 6:8106236-8106258 CCAGGCACTGTACAATGCACTGG + Intergenic
1004365990 6:15013173-15013195 CCAGGCACTGTTCTAGGCACAGG + Intergenic
1004823710 6:19398161-19398183 CCAGGCAATGTTCAGGTCACAGG - Intergenic
1004895176 6:20141176-20141198 CAGGGAAATGAGCAAAGCACAGG + Intronic
1004979623 6:21008678-21008700 CCAAGCACTGTGCAAGGAACTGG - Intronic
1006379616 6:33689944-33689966 CCAGGCTCTGAGCTGGGCACTGG + Intronic
1006443537 6:34066570-34066592 CCAGGCAGTGTTCTAGGCACTGG - Intronic
1006443763 6:34067640-34067662 CCAGGAACTGAGCAGGGCAGTGG - Intronic
1006679367 6:35786456-35786478 CCAGGCACTGTTCCAGGCACTGG - Intronic
1006834482 6:36988965-36988987 CCAGGCATTGAGCCAGGCTTGGG - Intergenic
1006851347 6:37101085-37101107 CCAGGCACTGAGCTAGGCACTGG - Intergenic
1006928074 6:37669800-37669822 CCAGGCACTGTGCTGGGCACTGG + Intronic
1007275942 6:40673864-40673886 CCAAGCACTGTGTAAGGCACTGG + Intergenic
1007597986 6:43063370-43063392 CCAGGCATTGTGCACTGCACTGG + Intronic
1007970628 6:46048675-46048697 CCAGGCAAGGAGGAAGGCCAGGG - Intronic
1008064652 6:47034588-47034610 CCAGGCATTGTGCCATGCACTGG + Intronic
1008552941 6:52650500-52650522 CCAGGCACTGTGCTAGGCACAGG + Intergenic
1009950080 6:70385439-70385461 CTTGTCAATGAGCAAGACACAGG - Intergenic
1010726152 6:79336240-79336262 CCAGGAACTGAGCAGAGCACTGG + Intergenic
1011252434 6:85386139-85386161 AAAGGAAATGAGTAAGGCACAGG + Intergenic
1011516225 6:88156698-88156720 CCAGGCACTGTGCCAGGCAGAGG - Intronic
1012406142 6:98901018-98901040 CCAGGCAATAGTCTAGGCACTGG + Intronic
1012414819 6:99001849-99001871 CCAGGCATTGTGCTAGGTACAGG + Intergenic
1013215173 6:108020634-108020656 GCAGGCCATGTGCCAGGCACTGG - Intergenic
1013581733 6:111541816-111541838 CCAGGCACTGTTCCAGGCACTGG + Intergenic
1014221146 6:118799992-118800014 CCAGGCACTGTGCTAGGCACTGG - Intergenic
1015189769 6:130459985-130460007 CCAGGCAAAGTGGAAGGCATGGG + Intergenic
1015888490 6:137945463-137945485 GCAGGTAATGAGCTAGGCATGGG + Intergenic
1017111213 6:150934532-150934554 CCAGGCACTGAGCTAGACGCTGG - Intronic
1017134984 6:151140175-151140197 CCAGGCACTGTTCTAGGCACTGG - Intergenic
1017195568 6:151696564-151696586 CCAGGCACTTCCCAAGGCACAGG - Intronic
1017529092 6:155269912-155269934 CCAGGCACTGATCCTGGCACAGG + Intronic
1017929438 6:158939295-158939317 CCAGACACTGAGCCAGGCAAGGG - Intergenic
1018039002 6:159905195-159905217 CCAGGCACTGTGCTAGGCACTGG - Intergenic
1018396280 6:163380222-163380244 CGAGACAAAGAGCAGGGCACTGG - Intergenic
1018657813 6:166056346-166056368 CCAGGCCATGTTCTAGGCACTGG - Intergenic
1019042917 6:169121098-169121120 TCAGGCAATTAGAAAGTCACGGG - Intergenic
1019501237 7:1365749-1365771 CCAGGCACTGTTCTAGGCACTGG + Intergenic
1020967603 7:14891399-14891421 CCAGGCAATGTTCAAACCACTGG + Intronic
1021194826 7:17663511-17663533 CCAGTCACTGTGTAAGGCACTGG + Intergenic
1021240597 7:18196134-18196156 CCAGGCACTGTGCAAGGCAATGG - Intronic
1022210500 7:28204377-28204399 CCAGGCACTGTCCAAGGCACTGG + Intergenic
1022294311 7:29035650-29035672 CCAGGCACTGTGCAAGGCCTGGG - Intronic
1022402167 7:30049738-30049760 ACAGGCAATGAGGGAGCCACTGG - Intronic
1022417299 7:30189278-30189300 CCAGGCACTGTGCTAGGCATAGG + Intergenic
1023542113 7:41276662-41276684 TCAGGTACTGAGCTAGGCACAGG - Intergenic
1023618232 7:42042740-42042762 CCAGGCTATGAGCAAGCCAAAGG - Intronic
1023888972 7:44379483-44379505 CCAGGCACTCAGCAAAGCCCTGG - Exonic
1024002862 7:45202477-45202499 ACAGGCAAGGAGCCAGGCCCTGG - Intergenic
1024081442 7:45859371-45859393 CCAGGTGATGAGGAAGGCAGCGG + Intergenic
1024651214 7:51404923-51404945 CCAGGTACTGAGCTAAGCACTGG - Intergenic
1025055346 7:55760504-55760526 CCAGGTACTGAGCTAAGCACTGG - Intergenic
1025133417 7:56390733-56390755 CCAGGTACTGAGCTAAGCACTGG - Intergenic
1025244076 7:57303011-57303033 CCAGGCAGTGTTCTAGGCACTGG + Intergenic
1025251966 7:57357454-57357476 CCAGGCACTGGGCAAGGCTCTGG + Intergenic
1025777588 7:64572699-64572721 CCTGGCAATGAGCATGGAACAGG - Intergenic
1025910623 7:65825656-65825678 CCAGGCACTGAGCTAAGCACTGG + Intergenic
1027266531 7:76497937-76497959 CCATGCAACGAGCAGGGCAGGGG - Intronic
1027317912 7:76996055-76996077 CCATGCAACGAGCAGGGCAGGGG - Intergenic
1027631806 7:80615618-80615640 CCAGGCTTTGAGCATGGCGCTGG - Intronic
1028783179 7:94760854-94760876 CCAGCCAATTTGCTAGGCACTGG - Intergenic
1028839515 7:95412809-95412831 CCAGGCACTGTTCCAGGCACTGG - Intronic
1030949135 7:115767335-115767357 CCAAGCAATGTGCTAGGCTCCGG - Intergenic
1031919338 7:127589372-127589394 GAAGGCAATGATCAAGGCCCAGG - Intronic
1032139802 7:129317616-129317638 CCAGTGACTGAGCAAGGCAGGGG - Intronic
1032162552 7:129521938-129521960 CCAGGCTATGAGGAAGGAGCTGG - Intergenic
1032469877 7:132170594-132170616 CCAGGCTCAGGGCAAGGCACTGG + Intronic
1032725127 7:134584012-134584034 CCAGGCAATGAGAATAGCAAGGG - Intergenic
1032864836 7:135915034-135915056 CCAGACACTGAGCTAGGCACTGG + Intergenic
1033280351 7:140002060-140002082 CCAGGCACTGTGCTAGGCCCGGG - Intronic
1033454729 7:141492479-141492501 CCAGGCATTGTGCTAGGCTCAGG - Intergenic
1033658138 7:143386986-143387008 CCAGGCATTTAGAATGGCACTGG + Intronic
1034440773 7:151084893-151084915 CCAGGCATTGTGCAAGATACTGG + Intergenic
1034986548 7:155519163-155519185 CTAGGCAAGCAGCAAGACACAGG - Intronic
1035655508 8:1302116-1302138 CCAGGTATGGAGCAAGGCTCAGG - Intergenic
1036065816 8:5380305-5380327 ACAGGCCAAGATCAAGGCACCGG - Intergenic
1036691350 8:10946701-10946723 CCAGGCACTGGGGTAGGCACAGG + Intronic
1037102319 8:15061730-15061752 GAAGTCATTGAGCAAGGCACTGG - Intronic
1037481124 8:19306662-19306684 CCATGCACTGAGCTAGGCTCTGG + Intergenic
1038219285 8:25592305-25592327 GCAGCCAATGGGCAAGTCACAGG - Intergenic
1039050004 8:33484541-33484563 ATAGGCAATGAGGAAGACACAGG + Intronic
1039418848 8:37419147-37419169 CCAGGGAATGAGCAGCTCACAGG + Intergenic
1039425047 8:37478626-37478648 CCAGGCACTGTGCTAGGTACTGG + Intergenic
1041188601 8:55329018-55329040 CCAGGAACTGATCTAGGCACTGG - Intronic
1041740458 8:61151722-61151744 CTAGGCACTGTGCAAGGCCCTGG - Intronic
1041903022 8:63002675-63002697 CCAGGCTTTGAGTTAGGCACAGG + Intergenic
1042186105 8:66137720-66137742 CCAGGCATTGGGCCAGGCAGAGG - Intronic
1042662321 8:71168517-71168539 CTAGGCATTGTGCTAGGCACTGG + Intergenic
1043202238 8:77384901-77384923 CCAGGTAGTAAGCTAGGCACAGG + Intergenic
1043880903 8:85541722-85541744 CCAGGCAATGTGCTAGGCACTGG + Intergenic
1043924007 8:86016255-86016277 CCAGGGATTGAGGAAGGCATGGG - Intronic
1044428387 8:92080708-92080730 CCAGGCACTGTGCTAGGCACTGG - Intronic
1044707252 8:95020699-95020721 CCAGGCACTTGGCCAGGCACTGG + Intronic
1044731241 8:95230202-95230224 CCAGGCATTGAGCCAGGTCCTGG - Intergenic
1044731292 8:95230652-95230674 CGATGCAATGAGGCAGGCACAGG + Intergenic
1044789926 8:95836814-95836836 CGAGGGAATGAGCAGGGTACAGG + Intergenic
1044810986 8:96061691-96061713 CCAGGCATTGTGCTAGGCACAGG - Intergenic
1044815372 8:96107320-96107342 CTAGGCAATGTTCAAGGCATGGG + Intergenic
1045206805 8:100050868-100050890 CCAGGCACTGTTCTAGGCACTGG + Intronic
1045967535 8:108042517-108042539 GCAGTTAATGAGCACGGCACGGG - Intronic
1046514554 8:115241479-115241501 CCTGGAAATGATCAAGGCAGAGG + Intergenic
1046823246 8:118658869-118658891 GCAGGCAATGTGCAGGGCTCTGG - Intergenic
1048013813 8:130480286-130480308 CCAGGCACTATGCTAGGCACAGG + Intergenic
1048292824 8:133193396-133193418 TCAGCCAAGGAGGAAGGCACTGG + Intronic
1048688568 8:136932848-136932870 CCAGGCACTGTGCTAGGCATTGG - Intergenic
1048927741 8:139286001-139286023 CCAGGCATGGAGCAAGGCCCTGG - Intergenic
1049360818 8:142211824-142211846 CCAGGCAAGGAGCAGTGCCCTGG + Intergenic
1049432895 8:142573528-142573550 CCAGGCCATGAGGAGGGCCCAGG + Intergenic
1050463859 9:5899794-5899816 CCAGGCACTGTGCTAGGCACTGG - Intronic
1051780196 9:20681695-20681717 CCAGGCACTGTGGTAGGCACAGG - Intronic
1052275013 9:26665522-26665544 CCAGGCACTGTGCTAAGCACTGG - Intergenic
1052773063 9:32706938-32706960 CCATGCAATGAGCAGGGCAGAGG - Intergenic
1052870813 9:33504670-33504692 CCAGGCACTGTTCTAGGCACTGG + Intergenic
1053260210 9:36656506-36656528 CCAGGCATAGGGCAAGGCCCTGG - Intronic
1053414890 9:37941187-37941209 CCAGACAATTTGCAATGCACTGG + Intronic
1053472580 9:38357545-38357567 CCAGGCTCTGGGCCAGGCACAGG - Intergenic
1053826919 9:42034888-42034910 CCAGGCATTGTGCTAGGCACTGG - Intronic
1054603641 9:67152543-67152565 CCAGGCATTGTGCTAGGCACTGG + Intergenic
1054821252 9:69522531-69522553 CCAGTCACTGTGCAAGGCAAAGG + Intronic
1054906305 9:70416862-70416884 CCTGGCAATGAGCTAGGCATGGG + Intergenic
1055134174 9:72807980-72808002 CCAGGCAATGTGCTAATCACAGG - Intronic
1055383846 9:75739711-75739733 CCAGGCATTGGACAAGGCACTGG - Intergenic
1056299154 9:85223862-85223884 CCAGGCAAAATGCAAGGCTCTGG - Intergenic
1056716020 9:89029700-89029722 AGATGGAATGAGCAAGGCACTGG + Intronic
1057082948 9:92186647-92186669 CCAGGCAAAGAGGAAGCCACTGG - Intergenic
1057687704 9:97250691-97250713 CCAGGCACTGTTCTAGGCACTGG - Intergenic
1057719379 9:97519724-97519746 CCAGGCACAGGGCAAGGCACTGG + Intronic
1059093541 9:111387954-111387976 CCAGGCACTGGGTAAGGTACTGG - Intronic
1059387137 9:113973364-113973386 CCAGGCCAAGAGGAAGGCGCTGG - Intronic
1059682639 9:116600928-116600950 CCTGGCAATGTACTAGGCACTGG + Intronic
1059993610 9:119888461-119888483 TCAGGCATTGAGCCAGGTACTGG + Intergenic
1059999240 9:119943498-119943520 CCAAGCACTGTGCCAGGCACTGG + Intergenic
1060080587 9:120640521-120640543 CCAGGCACTGTGCTAGGCACTGG - Intronic
1060190072 9:121586992-121587014 CCAGGCAGTGATCTAGGCACAGG + Intronic
1060254584 9:122015901-122015923 CCAGGCACTGTGATAGGCACTGG + Intronic
1060296411 9:122346674-122346696 CCAGGCCCTGTGCCAGGCACTGG - Intergenic
1060474988 9:123980008-123980030 CCAGGCCCTGAGCTAGGGACAGG - Intergenic
1060518985 9:124283212-124283234 CCAGGCCCTGGGCTAGGCACGGG - Intronic
1060815581 9:126633442-126633464 CCAGGCAATGAGCTAGGCCCAGG - Intronic
1060906546 9:127312225-127312247 CCAGGCAATGTGCAGAGCAATGG + Intronic
1061211536 9:129196325-129196347 CCAGGCACTGTGCTGGGCACAGG - Intergenic
1061262350 9:129487312-129487334 CCAGTCACTGTGCTAGGCACTGG - Intergenic
1061277582 9:129578360-129578382 CCAGGCACTGTGCCAGGGACAGG + Intergenic
1061644015 9:131984425-131984447 CCAGGCACTGTTCTAGGCACTGG + Intronic
1061932035 9:133838303-133838325 CCAGGCACTGTGCTAGGCAGAGG - Intronic
1062093679 9:134691748-134691770 CCAGGCCATGAGCAAGTGGCTGG - Intronic
1062490079 9:136800755-136800777 CCAGGCAATGAGAAAATGACAGG - Intronic
1185647413 X:1625001-1625023 CCAGGCAGTGACCAAGTCTCAGG + Intronic
1186794177 X:13028638-13028660 CCAGGCACGGTGCTAGGCACTGG + Intergenic
1187352589 X:18534557-18534579 CCAGGTACTGTGCTAGGCACTGG - Intronic
1187537590 X:20157254-20157276 CCAGGCATTCTGCTAGGCACTGG + Intronic
1188352558 X:29150174-29150196 CCAGGCTTCGTGCAAGGCACTGG + Intronic
1188497685 X:30796611-30796633 CAAGGCAAAAGGCAAGGCACAGG - Intergenic
1188498223 X:30800373-30800395 CAAGGCAAGGTGCAAGGCAAGGG - Intergenic
1188560056 X:31457392-31457414 CCAGGGAATGTTCTAGGCACTGG + Intronic
1188783715 X:34317328-34317350 CAAGGCAATTATCAAGGCAGTGG - Intergenic
1189169425 X:38894752-38894774 TCAGGCACTGTGCTAGGCACAGG + Intergenic
1189265549 X:39713363-39713385 CCAGGCAGTGTGCTAGACACAGG - Intergenic
1190012337 X:46796182-46796204 CAAGGCAAGGAGGAAGGCATAGG - Intergenic
1190483695 X:50902986-50903008 CCAGGCACTATGCTAGGCACTGG - Intergenic
1191141673 X:57121419-57121441 ACAGGCAAAGAGGAAGGCAGCGG + Exonic
1191983371 X:66951158-66951180 CAAGGCACTGAGCTAGGCATTGG + Intergenic
1192040580 X:67616765-67616787 CCAAGCCATGTGCTAGGCACAGG + Intronic
1192146809 X:68687983-68688005 CCGGGCACTGGGCAAGGGACAGG - Intronic
1192478090 X:71460919-71460941 CCAGGCACTGTGCTAGGCTCTGG + Intronic
1193074809 X:77344630-77344652 CCAGGCACTGTTCTAGGCACTGG + Intergenic
1194346300 X:92771188-92771210 CCAGGCAAGGAACCAGGTACTGG - Intergenic
1194358131 X:92914008-92914030 CCAGGCAATGTGGAAGGTACTGG - Intergenic
1194592312 X:95814533-95814555 CCAGGCACTATGCTAGGCACTGG + Intergenic
1195053488 X:101120827-101120849 CCAGGTACTGAGCCAGGCATTGG + Intronic
1196004783 X:110823984-110824006 CCAGGCAAAGAGAATGGCAAAGG + Intergenic
1196802919 X:119559652-119559674 CCAGGCACTGAGCTAGGTACTGG - Intronic
1197610834 X:128636395-128636417 CCAGGCACTGTTCAAGGCATGGG + Intergenic
1197955587 X:131943826-131943848 ACTGGCAATGACAAAGGCACTGG + Intergenic
1198086939 X:133290844-133290866 CCAGGTATTGTGCTAGGCACTGG - Intergenic
1198374839 X:136028459-136028481 CCAGGCACTGTACTAGGCACAGG - Intronic
1198511659 X:137358138-137358160 CCAGGCACAGTGCAAAGCACTGG - Intergenic
1199368833 X:147021042-147021064 CCAGGCACTTAGCCATGCACAGG - Intergenic
1199613360 X:149635794-149635816 CCGGGCACTGTGGAAGGCACTGG + Intergenic
1200644221 Y:5761346-5761368 TCAGGCAATAAGCAGGGCAATGG + Intergenic
1200654639 Y:5887837-5887859 CCAGGCAAGGAACCAGGTACTGG - Intergenic
1200666316 Y:6029659-6029681 CCAGGCAATGTGGAAGGTACTGG - Intergenic
1200736361 Y:6801019-6801041 CCAGAGAATGAGCAAGGTAGAGG - Intergenic
1201684293 Y:16683575-16683597 CCTAGCAATGAGCAAGGCTCTGG - Intergenic
1201773414 Y:17640245-17640267 CCATGAAATGAGCTAGGTACAGG + Intergenic
1201828141 Y:18265741-18265763 CCATGAAATGAGCTAGGTACAGG - Intergenic