ID: 1080513255

View in Genome Browser
Species Human (GRCh38)
Location 11:32996391-32996413
Sequence TAGCCAAAACAATATGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080513255_1080513260 8 Left 1080513255 11:32996391-32996413 CCAGTACCATATTGTTTTGGCTA No data
Right 1080513260 11:32996422-32996444 CTGTAGTATAGTTTGAAGTTGGG No data
1080513255_1080513259 7 Left 1080513255 11:32996391-32996413 CCAGTACCATATTGTTTTGGCTA No data
Right 1080513259 11:32996421-32996443 CCTGTAGTATAGTTTGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080513255 Original CRISPR TAGCCAAAACAATATGGTAC TGG (reversed) Intergenic