ID: 1080513255 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:32996391-32996413 |
Sequence | TAGCCAAAACAATATGGTAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1080513255_1080513260 | 8 | Left | 1080513255 | 11:32996391-32996413 | CCAGTACCATATTGTTTTGGCTA | No data | ||
Right | 1080513260 | 11:32996422-32996444 | CTGTAGTATAGTTTGAAGTTGGG | No data | ||||
1080513255_1080513259 | 7 | Left | 1080513255 | 11:32996391-32996413 | CCAGTACCATATTGTTTTGGCTA | No data | ||
Right | 1080513259 | 11:32996421-32996443 | CCTGTAGTATAGTTTGAAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1080513255 | Original CRISPR | TAGCCAAAACAATATGGTAC TGG (reversed) | Intergenic | ||