ID: 1080513255 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:32996391-32996413 |
| Sequence | TAGCCAAAACAATATGGTAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1080513255_1080513260 | 8 | Left | 1080513255 | 11:32996391-32996413 | CCAGTACCATATTGTTTTGGCTA | No data | ||
| Right | 1080513260 | 11:32996422-32996444 | CTGTAGTATAGTTTGAAGTTGGG | 0: 199 1: 1154 2: 15403 3: 8886 4: 5634 |
||||
| 1080513255_1080513259 | 7 | Left | 1080513255 | 11:32996391-32996413 | CCAGTACCATATTGTTTTGGCTA | No data | ||
| Right | 1080513259 | 11:32996421-32996443 | CCTGTAGTATAGTTTGAAGTTGG | 0: 188 1: 797 2: 1153 3: 1041 4: 885 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1080513255 | Original CRISPR | TAGCCAAAACAATATGGTAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||